EMAIL THIS PAGE TO A FRIEND

CAPN12

calpain 12

UniProtKB ID: Q6ZSI9
Gene ID:
Human(147968) Summary: The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Mouse(60594) calpain 12
Rat(308476) calpain 12
sheep(101112842) calpain 12
Zebrafish(799247) calpain 12
cow(530544) calpain 12
dog(484525) calpain 12
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144691 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001110807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001110807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001110807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160651 MISSION® esiRNA esiRNA human CAPN12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144691 Rosetta Predictions human pricing
NM_001110808 Rosetta Predictions rat pricing
NM_001110807 Rosetta Predictions mouse pricing
NM_021894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237726 predicted 463
2 SASI_Hs01_00237727 predicted 562
3 SASI_Hs01_00237728 predicted 2256
4 SASI_Hs01_00237729 predicted 2619
5 SASI_Hs02_00364613 predicted 511
6 SASI_Hs01_00237730 predicted 504
7 SASI_Hs01_00237731 predicted 942
8 SASI_Hs01_00237732 predicted 553
9 SASI_Hs01_00237733 predicted 2312
10 SASI_Hs01_00237734 predicted 2627
11 SASI_Hs01_00237735 predicted 2329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251352 predicted 1932
2 SASI_Rn02_00251353 predicted 864
3 SASI_Rn02_00251354 predicted 1089
4 SASI_Rn02_00251355 predicted 895
5 SASI_Rn02_00251356 predicted 1983
6 SASI_Rn02_00251357 predicted 2084
7 SASI_Rn02_00251358 predicted 1638
8 SASI_Rn02_00251359 predicted 521
9 SASI_Rn02_00251360 predicted 683
10 SASI_Rn02_00251361 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305778 predicted 1593
2 SASI_Mm02_00305779 predicted 1927
3 SASI_Mm02_00305780 predicted 861
4 SASI_Mm02_00305781 predicted 561
5 SASI_Mm02_00305782 predicted 1159
6 SASI_Mm02_00305783 predicted 1063
7 SASI_Mm02_00305784 predicted 193
8 SASI_Mm02_00305785 predicted 646
9 SASI_Mm02_00305786 predicted 568
10 SASI_Mm02_00305787 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167088 predicted 243
2 SASI_Mm01_00167089 predicted 797
3 SASI_Mm01_00167090 predicted 874
4 SASI_Mm01_00167091 predicted 1421
5 SASI_Mm01_00167092 predicted 1322
6 SASI_Mm01_00167093 predicted 575
7 SASI_Mm01_00167094 predicted 569
8 SASI_Mm01_00167095 predicted 762
9 SASI_Mm01_00167096 predicted 977
10 SASI_Mm01_00167097 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144691
CAPN12 MISSION shRNA Bacterial Glycerol Stock
calpain 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-2188s1c1
Sequence:CCGGGCCATATTCAACAAGTTCGATCTCGAGATCGAACTTGTTGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-1425s1c1
Sequence:CCGGCCAGCCTAATGCTGAAACCTTCTCGAGAAGGTTTCAGCATTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-512s1c1
Sequence:CCGGAGAAGGCCAAAGGCGTGAAATCTCGAGATTTCACGCCTTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-947s1c1
Sequence:CCGGAGGTGCTCTATCTGAGACAAACTCGAGTTTGTCTCAGATAGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-559s1c1
Sequence:CCGGGAGCCGAAGTTCATCTGTGAACTCGAGTTCACAGATGAACTTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144691.3-2688s21c1
Sequence:CCGGTAGTCCACGTTGACAGCTTAACTCGAGTTAAGCTGTCAACGTGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144691.3-395s21c1
Sequence:CCGGGCCAGAGCTATGAGGCAATTCCTCGAGGAATTGCCTCATAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144691
CAPN12 MISSION shRNA shRNA Plasmid DNA
calpain 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-2188s1c1
Sequence:CCGGGCCATATTCAACAAGTTCGATCTCGAGATCGAACTTGTTGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-1425s1c1
Sequence:CCGGCCAGCCTAATGCTGAAACCTTCTCGAGAAGGTTTCAGCATTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-512s1c1
Sequence:CCGGAGAAGGCCAAAGGCGTGAAATCTCGAGATTTCACGCCTTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-947s1c1
Sequence:CCGGAGGTGCTCTATCTGAGACAAACTCGAGTTTGTCTCAGATAGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-559s1c1
Sequence:CCGGGAGCCGAAGTTCATCTGTGAACTCGAGTTCACAGATGAACTTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144691.3-2688s21c1
Sequence:CCGGTAGTCCACGTTGACAGCTTAACTCGAGTTAAGCTGTCAACGTGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144691.3-395s21c1
Sequence:CCGGGCCAGAGCTATGAGGCAATTCCTCGAGGAATTGCCTCATAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144691
CAPN12 MISSION shRNA Lentiviral Transduction Particles
calpain 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-2188s1c1
Sequence:CCGGGCCATATTCAACAAGTTCGATCTCGAGATCGAACTTGTTGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-1425s1c1
Sequence:CCGGCCAGCCTAATGCTGAAACCTTCTCGAGAAGGTTTCAGCATTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-512s1c1
Sequence:CCGGAGAAGGCCAAAGGCGTGAAATCTCGAGATTTCACGCCTTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-947s1c1
Sequence:CCGGAGGTGCTCTATCTGAGACAAACTCGAGTTTGTCTCAGATAGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144691.2-559s1c1
Sequence:CCGGGAGCCGAAGTTCATCTGTGAACTCGAGTTCACAGATGAACTTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144691.3-2688s21c1
Sequence:CCGGTAGTCCACGTTGACAGCTTAACTCGAGTTAAGCTGTCAACGTGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144691.3-395s21c1
Sequence:CCGGGCCAGAGCTATGAGGCAATTCCTCGAGGAATTGCCTCATAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021894
CAPN12 MISSION shRNA Bacterial Glycerol Stock
calpain 12
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000030699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-583s1c1
Sequence:CCGGCTCAGAACAAAGGAACGAGTTCTCGAGAACTCGTTCCTTTGTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-331s1c1
Sequence:CCGGCCAGTTCATCTGTGAAGACATCTCGAGATGTCTTCACAGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-1162s1c1
Sequence:CCGGCTACCTTCTCATAGGTTTGAACTCGAGTTCAAACCTATGAGAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-713s1c1
Sequence:CCGGGAGGTCCTCTACTTGAGACAACTCGAGTTGTCTCAAGTAGAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021894
CAPN12 MISSION shRNA shRNA Plasmid DNA
calpain 12
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000030699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-583s1c1
Sequence:CCGGCTCAGAACAAAGGAACGAGTTCTCGAGAACTCGTTCCTTTGTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-331s1c1
Sequence:CCGGCCAGTTCATCTGTGAAGACATCTCGAGATGTCTTCACAGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-1162s1c1
Sequence:CCGGCTACCTTCTCATAGGTTTGAACTCGAGTTCAAACCTATGAGAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-713s1c1
Sequence:CCGGGAGGTCCTCTACTTGAGACAACTCGAGTTGTCTCAAGTAGAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021894
CAPN12 MISSION shRNA Lentiviral Transduction Particles
calpain 12
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000030699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-583s1c1
Sequence:CCGGCTCAGAACAAAGGAACGAGTTCTCGAGAACTCGTTCCTTTGTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-331s1c1
Sequence:CCGGCCAGTTCATCTGTGAAGACATCTCGAGATGTCTTCACAGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-1162s1c1
Sequence:CCGGCTACCTTCTCATAGGTTTGAACTCGAGTTCAAACCTATGAGAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021894.1-713s1c1
Sequence:CCGGGAGGTCCTCTACTTGAGACAACTCGAGTTGTCTCAAGTAGAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110807
CAPN12 MISSION shRNA Bacterial Glycerol Stock
calpain 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-833s21c1
Sequence:CCGGGGTGAAGGGACATGCTTATTCCTCGAGGAATAAGCATGTCCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-1777s21c1
Sequence:CCGGTTCAGCTGCAGACCTTAATAACTCGAGTTATTAAGGTCTGCAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-520s21c1
Sequence:CCGGATGTGGTGGTAGACGACAAACCTCGAGGTTTGTCGTCTACCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110807.1-2480s21c1
Sequence:CCGGTGACACCAGAGTCCTTCTTAACTCGAGTTAAGAAGGACTCTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-632s21c1
Sequence:CCGGCCATGGCTCCTACGAGGTAATCTCGAGATTACCTCGTAGGAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110807
CAPN12 MISSION shRNA shRNA Plasmid DNA
calpain 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-833s21c1
Sequence:CCGGGGTGAAGGGACATGCTTATTCCTCGAGGAATAAGCATGTCCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-1777s21c1
Sequence:CCGGTTCAGCTGCAGACCTTAATAACTCGAGTTATTAAGGTCTGCAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-520s21c1
Sequence:CCGGATGTGGTGGTAGACGACAAACCTCGAGGTTTGTCGTCTACCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110807.1-2480s21c1
Sequence:CCGGTGACACCAGAGTCCTTCTTAACTCGAGTTAAGAAGGACTCTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-632s21c1
Sequence:CCGGCCATGGCTCCTACGAGGTAATCTCGAGATTACCTCGTAGGAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110807
CAPN12 MISSION shRNA Lentiviral Transduction Particles
calpain 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-833s21c1
Sequence:CCGGGGTGAAGGGACATGCTTATTCCTCGAGGAATAAGCATGTCCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-1777s21c1
Sequence:CCGGTTCAGCTGCAGACCTTAATAACTCGAGTTATTAAGGTCTGCAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-520s21c1
Sequence:CCGGATGTGGTGGTAGACGACAAACCTCGAGGTTTGTCGTCTACCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110807.1-2480s21c1
Sequence:CCGGTGACACCAGAGTCCTTCTTAACTCGAGTTAAGAAGGACTCTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110807.1-632s21c1
Sequence:CCGGCCATGGCTCCTACGAGGTAATCTCGAGATTACCTCGTAGGAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks