EMAIL THIS PAGE TO A FRIEND

CAPN13

calpain 13

127 Gene Product Result for
UniProtKB ID: Q6MZZ7, Q17RF0, Q580X1, Q8TE80
Gene ID:
Human(92291) Summary: The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Mouse(381122) calpain 13
Rat(362701) calpain 13
chicken(421304) calpain 13
cow(526038) calpain 13
dog(483024) calpain 13
sheep(101104136) calpain 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144575 Rosetta Predictions human pricing
NM_001025133 Rosetta Predictions rat pricing
NM_001033444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165756 predicted 1148
2 SASI_Hs01_00165757 predicted 1081
3 SASI_Hs02_00364356 predicted 973
4 SASI_Hs01_00165759 predicted 1822
5 SASI_Hs01_00165760 predicted 1147
6 SASI_Hs01_00165761 predicted 1434
7 SASI_Hs01_00165762 predicted 1202
8 SASI_Hs01_00165763 predicted 407
9 SASI_Hs01_00165765 predicted 618
10 SASI_Hs02_00364357 predicted 1147
11 SASI_Hs01_00165758 predicted 2274
12 SASI_Hs01_00165764 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050126 predicted 1114
2 SASI_Rn01_00050127 predicted 2035
3 SASI_Rn01_00050128 predicted 1259
4 SASI_Rn01_00050129 predicted 1992
5 SASI_Rn02_00203054 predicted 782
6 SASI_Rn01_00050130 predicted 316
7 SASI_Rn01_00050131 predicted 1100
8 SASI_Rn01_00050132 predicted 1913
9 SASI_Rn01_00050133 predicted 1281
10 SASI_Rn01_00050134 predicted 1175
11 SASI_Rn01_00050135 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193091 predicted 1348
2 SASI_Mm01_00193092 predicted 1698
3 SASI_Mm01_00193093 predicted 1544
4 SASI_Mm01_00193094 predicted 1826
5 SASI_Mm01_00193095 predicted 1188
6 SASI_Mm01_00193096 predicted 1170
7 SASI_Mm01_00193097 predicted 1512
8 SASI_Mm01_00193098 predicted 1977
9 SASI_Mm01_00193099 predicted 680
10 SASI_Mm01_00193100 predicted 1489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144575
CAPN13 MISSION shRNA Bacterial Glycerol Stock
calpain 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1472s21c1
Sequence:CCGGCACTGTCCAAAGCTCAAATAACTCGAGTTATTTGAGCTTTGGACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1207s21c1
Sequence:CCGGACGAAGGATGGTCCCAAATAACTCGAGTTATTTGGGACCATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1346s21c1
Sequence:CCGGTGCTGTCACACCATCAAATTTCTCGAGAAATTTGATGGTGTGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144575.2-2273s1c1
Sequence:CCGGCCCAGTATGGTGGTTGTGATACTCGAGTATCACAACCACCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1152s1c1
Sequence:CCGGGCCATGTTTATATGTAGCGAACTCGAGTTCGCTACATATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-404s1c1
Sequence:CCGGCCTGGATGATATAAGCAGATTCTCGAGAATCTGCTTATATCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1389s1c1
Sequence:CCGGCCACTCGATTTCCAAGTGATTCTCGAGAATCACTTGGAAATCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1153s1c1
Sequence:CCGGCCATGTTTATATGTAGCGAAACTCGAGTTTCGCTACATATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144575
CAPN13 MISSION shRNA shRNA Plasmid DNA
calpain 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1472s21c1
Sequence:CCGGCACTGTCCAAAGCTCAAATAACTCGAGTTATTTGAGCTTTGGACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1207s21c1
Sequence:CCGGACGAAGGATGGTCCCAAATAACTCGAGTTATTTGGGACCATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1346s21c1
Sequence:CCGGTGCTGTCACACCATCAAATTTCTCGAGAAATTTGATGGTGTGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144575.2-2273s1c1
Sequence:CCGGCCCAGTATGGTGGTTGTGATACTCGAGTATCACAACCACCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1152s1c1
Sequence:CCGGGCCATGTTTATATGTAGCGAACTCGAGTTCGCTACATATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-404s1c1
Sequence:CCGGCCTGGATGATATAAGCAGATTCTCGAGAATCTGCTTATATCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1389s1c1
Sequence:CCGGCCACTCGATTTCCAAGTGATTCTCGAGAATCACTTGGAAATCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1153s1c1
Sequence:CCGGCCATGTTTATATGTAGCGAAACTCGAGTTTCGCTACATATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144575
CAPN13 MISSION shRNA Lentiviral Transduction Particles
calpain 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1472s21c1
Sequence:CCGGCACTGTCCAAAGCTCAAATAACTCGAGTTATTTGAGCTTTGGACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1207s21c1
Sequence:CCGGACGAAGGATGGTCCCAAATAACTCGAGTTATTTGGGACCATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144575.2-1346s21c1
Sequence:CCGGTGCTGTCACACCATCAAATTTCTCGAGAAATTTGATGGTGTGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144575.2-2273s1c1
Sequence:CCGGCCCAGTATGGTGGTTGTGATACTCGAGTATCACAACCACCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1152s1c1
Sequence:CCGGGCCATGTTTATATGTAGCGAACTCGAGTTCGCTACATATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-404s1c1
Sequence:CCGGCCTGGATGATATAAGCAGATTCTCGAGAATCTGCTTATATCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1389s1c1
Sequence:CCGGCCACTCGATTTCCAAGTGATTCTCGAGAATCACTTGGAAATCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144575.2-1153s1c1
Sequence:CCGGCCATGTTTATATGTAGCGAAACTCGAGTTTCGCTACATATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033444
CAPN13 MISSION shRNA Bacterial Glycerol Stock
calpain 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-690s21c1
Sequence:GTACCGGCCTATTCCCAATTACACTATGCTCGAGCATAGTGTAATTGGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033444.2-2257s21c1
Sequence:CCGGTGCAGCTAAACCTGGTATTTGCTCGAGCAAATACCAGGTTTAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1841s21c1
Sequence:CCGGAGACTCCGAAGTCGCCTTATCCTCGAGGATAAGGCGACTTCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1177s21c1
Sequence:CCGGCAATGAGAGCTGGCGACAAATCTCGAGATTTGTCGCCAGCTCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-586s21c1
Sequence:CCGGATTGCCCGTCATAGGCGATAACTCGAGTTATCGCCTATGACGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-211s21c1
Sequence:CCGGCAGGACCTTACGGGATCATTGCTCGAGCAATGATCCCGTAAGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1087s21c1
Sequence:CCGGTTGGATGTCCTGTCAAGATTTCTCGAGAAATCTTGACAGGACATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033444.2-2439s21c1
Sequence:CCGGACACTCTCCCTGGATCCATTTCTCGAGAAATGGATCCAGGGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1589s21c1
Sequence:CCGGAGGGATCCAAGCAGCAATTTCCTCGAGGAAATTGCTGCTTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1248s21c1
Sequence:CCGGGGGATATGCAGTATGTCTTTACTCGAGTAAAGACATACTGCATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033444
CAPN13 MISSION shRNA shRNA Plasmid DNA
calpain 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-690s21c1
Sequence:GTACCGGCCTATTCCCAATTACACTATGCTCGAGCATAGTGTAATTGGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033444.2-2257s21c1
Sequence:CCGGTGCAGCTAAACCTGGTATTTGCTCGAGCAAATACCAGGTTTAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1841s21c1
Sequence:CCGGAGACTCCGAAGTCGCCTTATCCTCGAGGATAAGGCGACTTCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1177s21c1
Sequence:CCGGCAATGAGAGCTGGCGACAAATCTCGAGATTTGTCGCCAGCTCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-586s21c1
Sequence:CCGGATTGCCCGTCATAGGCGATAACTCGAGTTATCGCCTATGACGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-211s21c1
Sequence:CCGGCAGGACCTTACGGGATCATTGCTCGAGCAATGATCCCGTAAGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1087s21c1
Sequence:CCGGTTGGATGTCCTGTCAAGATTTCTCGAGAAATCTTGACAGGACATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033444.2-2439s21c1
Sequence:CCGGACACTCTCCCTGGATCCATTTCTCGAGAAATGGATCCAGGGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1589s21c1
Sequence:CCGGAGGGATCCAAGCAGCAATTTCCTCGAGGAAATTGCTGCTTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1248s21c1
Sequence:CCGGGGGATATGCAGTATGTCTTTACTCGAGTAAAGACATACTGCATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033444
CAPN13 MISSION shRNA Lentiviral Transduction Particles
calpain 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-690s21c1
Sequence:GTACCGGCCTATTCCCAATTACACTATGCTCGAGCATAGTGTAATTGGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033444.2-2257s21c1
Sequence:CCGGTGCAGCTAAACCTGGTATTTGCTCGAGCAAATACCAGGTTTAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1841s21c1
Sequence:CCGGAGACTCCGAAGTCGCCTTATCCTCGAGGATAAGGCGACTTCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1177s21c1
Sequence:CCGGCAATGAGAGCTGGCGACAAATCTCGAGATTTGTCGCCAGCTCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-586s21c1
Sequence:CCGGATTGCCCGTCATAGGCGATAACTCGAGTTATCGCCTATGACGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-211s21c1
Sequence:CCGGCAGGACCTTACGGGATCATTGCTCGAGCAATGATCCCGTAAGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1087s21c1
Sequence:CCGGTTGGATGTCCTGTCAAGATTTCTCGAGAAATCTTGACAGGACATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033444.2-2439s21c1
Sequence:CCGGACACTCTCCCTGGATCCATTTCTCGAGAAATGGATCCAGGGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1589s21c1
Sequence:CCGGAGGGATCCAAGCAGCAATTTCCTCGAGGAAATTGCTGCTTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033444.2-1248s21c1
Sequence:CCGGGGGATATGCAGTATGTCTTTACTCGAGTAAAGACATACTGCATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks