EMAIL THIS PAGE TO A FRIEND

CAPN14

calpain 14

41 Gene Product Result for
UniProtKB ID: A8MX76, B3KRU9
Gene ID:
Human(440854) Summary: Calpains are a family of cytosolic calcium-activated cysteine proteases involved in a variety of cellular processes including apoptosis, cell division, modulation of integrin-cytoskeletal interactions, and synaptic plasticity (Dear et al., 2000 [PubMed 10964513]
sheep(101104645) calpain 14
chicken(768684) calpain 14
cow(515741) calpain 14
dog(483026) calpain 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145122 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221881 MISSION® esiRNA esiRNA targeting human CAPN14 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017761 Rosetta Predictions human pricing
XR_040604 Rosetta Predictions human pricing
XR_040605 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494372 predicted 864
2 SASI_Hs02_00494373 predicted 1367
3 SASI_Hs02_00494374 predicted 1556
4 SASI_Hs02_00494375 predicted 2863
5 SASI_Hs02_00494376 predicted 1833
6 SASI_Hs02_00494377 predicted 1952
7 SASI_Hs02_00494378 predicted 1827
8 SASI_Hs02_00494379 predicted 1801
9 SASI_Hs02_00494380 predicted 1027
10 SASI_Hs02_00494381 predicted 2769
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520346 predicted 1394
2 SASI_Hs02_00520347 predicted 897
3 SASI_Hs02_00520348 predicted 1578
4 SASI_Hs02_00520349 predicted 621
5 SASI_Hs02_00520350 predicted 1858
6 SASI_Hs02_00520351 predicted 1852
7 SASI_Hs02_00520352 predicted 933
8 SASI_Hs02_00520353 predicted 1831
9 SASI_Hs02_00520354 predicted 1062
10 SASI_Hs02_00520355 predicted 1652
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520356 predicted 865
2 SASI_Hs02_00520357 predicted 1366
3 SASI_Hs02_00520358 predicted 1553
4 SASI_Hs02_00520359 predicted 2864
5 SASI_Hs02_00520360 predicted 1828
6 SASI_Hs02_00520361 predicted 1956
7 SASI_Hs02_00520362 predicted 1822
8 SASI_Hs02_00520363 predicted 1799
9 SASI_Hs02_00520364 predicted 1027
10 SASI_Hs02_00520365 predicted 2772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145122
CAPN14 MISSION shRNA Bacterial Glycerol Stock
calpain 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145122.1-2666s21c1
Sequence:CCGGTAGAGACATAGGCTAAGTTTCCTCGAGGAAACTTAGCCTATGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1398s21c1
Sequence:CCGGCCATTGGCTTCTACCTGTATACTCGAGTATACAGGTAGAAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-631s21c1
Sequence:CCGGCTTTGTCTCCTCCACCTATAACTCGAGTTATAGGTGGAGGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1853s21c1
Sequence:CCGGCTTAATGCATCAGGTACTATGCTCGAGCATAGTACCTGATGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1094s21c1
Sequence:CCGGATGACGCTGCAGGACTTTAAACTCGAGTTTAAAGTCCTGCAGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145122
CAPN14 MISSION shRNA shRNA Plasmid DNA
calpain 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145122.1-2666s21c1
Sequence:CCGGTAGAGACATAGGCTAAGTTTCCTCGAGGAAACTTAGCCTATGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1398s21c1
Sequence:CCGGCCATTGGCTTCTACCTGTATACTCGAGTATACAGGTAGAAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-631s21c1
Sequence:CCGGCTTTGTCTCCTCCACCTATAACTCGAGTTATAGGTGGAGGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1853s21c1
Sequence:CCGGCTTAATGCATCAGGTACTATGCTCGAGCATAGTACCTGATGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1094s21c1
Sequence:CCGGATGACGCTGCAGGACTTTAAACTCGAGTTTAAAGTCCTGCAGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145122
CAPN14 MISSION shRNA Lentiviral Transduction Particles
calpain 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145122.1-2666s21c1
Sequence:CCGGTAGAGACATAGGCTAAGTTTCCTCGAGGAAACTTAGCCTATGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1398s21c1
Sequence:CCGGCCATTGGCTTCTACCTGTATACTCGAGTATACAGGTAGAAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-631s21c1
Sequence:CCGGCTTTGTCTCCTCCACCTATAACTCGAGTTATAGGTGGAGGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1853s21c1
Sequence:CCGGCTTAATGCATCAGGTACTATGCTCGAGCATAGTACCTGATGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145122.1-1094s21c1
Sequence:CCGGATGACGCTGCAGGACTTTAAACTCGAGTTTAAAGTCCTGCAGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks