EMAIL THIS PAGE TO A FRIEND

CAPN15

calpain 15

64 Gene Product Result for
Synonyms: SOLH
Gene ID:
Human(6650) Summary: This gene encodes a protein containing zinc-finger-like repeats and a calpain-like protease domain. The encoded protein may function as a transcription factor, RNA-binding protein, or in protein-protein interactions during visual system development. [provided by RefSeq, Jul 2008]
Mouse(50817) calpain 15
Rat(303000) calpain 15
cow(522068) calpain 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004011 MISSION® esiRNA esiRNA targeting mouse Solh (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005632 Rosetta Predictions human pricing
NM_001106990 Rosetta Predictions rat pricing
NM_015830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216334 predicted 1920
2 SASI_Hs01_00216335 predicted 3358
3 SASI_Hs01_00216336 predicted 2547
4 SASI_Hs01_00216337 predicted 451
5 SASI_Hs01_00216338 predicted 1220
6 SASI_Hs01_00216339 predicted 2970
7 SASI_Hs01_00216340 predicted 3033
8 SASI_Hs01_00216341 predicted 1396
9 SASI_Hs01_00216342 predicted 1951
10 SASI_Hs01_00216343 predicted 2684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224396 predicted 2202
2 SASI_Rn02_00224397 predicted 1053
3 SASI_Rn02_00224398 predicted 2718
4 SASI_Rn02_00224399 predicted 1375
5 SASI_Rn02_00224400 predicted 1288
6 SASI_Rn02_00224401 predicted 1900
7 SASI_Rn02_00224402 predicted 2679
8 SASI_Rn02_00224403 predicted 611
9 SASI_Rn02_00224404 predicted 2275
10 SASI_Rn02_00224405 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040954 predicted 1883
2 SASI_Mm01_00040955 predicted 2050
3 SASI_Mm02_00323258 predicted 1959
4 SASI_Mm01_00040956 predicted 1230
5 SASI_Mm01_00040958 predicted 1054
6 SASI_Mm01_00040959 predicted 2044
7 SASI_Mm01_00040960 predicted 731
8 SASI_Mm01_00040961 predicted 2182
9 SASI_Mm01_00040962 predicted 1470
10 SASI_Mm01_00040963 predicted 2354
11 SASI_Mm01_00040957 predicted 2125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015830
VALIDATED
CAPN15 MISSION shRNA Bacterial Glycerol Stock
calpain 15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-977s21c1
Sequence:CCGGAGTCGTGCAGTGATGTCATTGCTCGAGCAATGACATCACTGCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-1442s21c1
Sequence:CCGGAGGCACTCTGGGAGAACATAGCTCGAGCTATGTTCTCCCAGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-1065s21c1
Sequence:CCGGATGTGCCAGGTGTACACTTAGCTCGAGCTAAGTGTACACCTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-2937s21c1
Sequence:CCGGAGAGGGCATGACCTGCTATTACTCGAGTAATAGCAGGTCATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015830.1-154s1c1
Sequence:CCGGCGCTGTACATTCCGGAACTTTCTCGAGAAAGTTCCGGAATGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-1449s1c1
Sequence:CCGGCTGGGAGAACATAGTGGCTTTCTCGAGAAAGCCACTATGTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015830.1-2179s1c1
Sequence:CCGGCATGCTTACTCTGTCTTGGATCTCGAGATCCAAGACAGAGTAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-2182s1c1
Sequence:CCGGGCTTACTCTGTCTTGGATGTTCTCGAGAACATCCAAGACAGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-2043s1c1
Sequence:CCGGGCCTGTTGACACTGATCTCATCTCGAGATGAGATCAGTGTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015830
VALIDATED
CAPN15 MISSION shRNA shRNA Plasmid DNA
calpain 15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-977s21c1
Sequence:CCGGAGTCGTGCAGTGATGTCATTGCTCGAGCAATGACATCACTGCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-1442s21c1
Sequence:CCGGAGGCACTCTGGGAGAACATAGCTCGAGCTATGTTCTCCCAGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-1065s21c1
Sequence:CCGGATGTGCCAGGTGTACACTTAGCTCGAGCTAAGTGTACACCTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-2937s21c1
Sequence:CCGGAGAGGGCATGACCTGCTATTACTCGAGTAATAGCAGGTCATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015830.1-154s1c1
Sequence:CCGGCGCTGTACATTCCGGAACTTTCTCGAGAAAGTTCCGGAATGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-1449s1c1
Sequence:CCGGCTGGGAGAACATAGTGGCTTTCTCGAGAAAGCCACTATGTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015830.1-2179s1c1
Sequence:CCGGCATGCTTACTCTGTCTTGGATCTCGAGATCCAAGACAGAGTAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-2182s1c1
Sequence:CCGGGCTTACTCTGTCTTGGATGTTCTCGAGAACATCCAAGACAGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-2043s1c1
Sequence:CCGGGCCTGTTGACACTGATCTCATCTCGAGATGAGATCAGTGTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015830
VALIDATED
CAPN15 MISSION shRNA Lentiviral Transduction Particles
calpain 15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-977s21c1
Sequence:CCGGAGTCGTGCAGTGATGTCATTGCTCGAGCAATGACATCACTGCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-1442s21c1
Sequence:CCGGAGGCACTCTGGGAGAACATAGCTCGAGCTATGTTCTCCCAGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-1065s21c1
Sequence:CCGGATGTGCCAGGTGTACACTTAGCTCGAGCTAAGTGTACACCTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015830.1-2937s21c1
Sequence:CCGGAGAGGGCATGACCTGCTATTACTCGAGTAATAGCAGGTCATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015830.1-154s1c1
Sequence:CCGGCGCTGTACATTCCGGAACTTTCTCGAGAAAGTTCCGGAATGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-1449s1c1
Sequence:CCGGCTGGGAGAACATAGTGGCTTTCTCGAGAAAGCCACTATGTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015830.1-2179s1c1
Sequence:CCGGCATGCTTACTCTGTCTTGGATCTCGAGATCCAAGACAGAGTAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-2182s1c1
Sequence:CCGGGCTTACTCTGTCTTGGATGTTCTCGAGAACATCCAAGACAGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015830.1-2043s1c1
Sequence:CCGGGCCTGTTGACACTGATCTCATCTCGAGATGAGATCAGTGTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005632
VALIDATED
CAPN15 MISSION shRNA Bacterial Glycerol Stock
calpain 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005632.2-4579s1c1
Sequence:CCGGCCTGTACTCTGAGCTGTGAATCTCGAGATTCACAGCTCAGAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-516s1c1
Sequence:CCGGCCGCTGCACCTTCCGCAACTTCTCGAGAAGTTGCGGAAGGTGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-2376s1c1
Sequence:CCGGGCCCGTTGACACTGACCTCATCTCGAGATGAGGTCAGTGTCAACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-1806s1c1
Sequence:CCGGCCGGGAGAACAATGTGAGCTTCTCGAGAAGCTCACATTGTTCTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005632.2-2694s1c1
Sequence:CCGGCGGCGACTTTGTCAGGTACTTCTCGAGAAGTACCTGACAAAGTCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005632
VALIDATED
CAPN15 MISSION shRNA shRNA Plasmid DNA
calpain 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005632.2-4579s1c1
Sequence:CCGGCCTGTACTCTGAGCTGTGAATCTCGAGATTCACAGCTCAGAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-516s1c1
Sequence:CCGGCCGCTGCACCTTCCGCAACTTCTCGAGAAGTTGCGGAAGGTGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-2376s1c1
Sequence:CCGGGCCCGTTGACACTGACCTCATCTCGAGATGAGGTCAGTGTCAACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-1806s1c1
Sequence:CCGGCCGGGAGAACAATGTGAGCTTCTCGAGAAGCTCACATTGTTCTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005632.2-2694s1c1
Sequence:CCGGCGGCGACTTTGTCAGGTACTTCTCGAGAAGTACCTGACAAAGTCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005632
VALIDATED
CAPN15 MISSION shRNA Lentiviral Transduction Particles
calpain 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005632.2-4579s1c1
Sequence:CCGGCCTGTACTCTGAGCTGTGAATCTCGAGATTCACAGCTCAGAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-516s1c1
Sequence:CCGGCCGCTGCACCTTCCGCAACTTCTCGAGAAGTTGCGGAAGGTGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-2376s1c1
Sequence:CCGGGCCCGTTGACACTGACCTCATCTCGAGATGAGGTCAGTGTCAACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005632.2-1806s1c1
Sequence:CCGGCCGGGAGAACAATGTGAGCTTCTCGAGAAGCTCACATTGTTCTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005632.2-2694s1c1
Sequence:CCGGCGGCGACTTTGTCAGGTACTTCTCGAGAAGTACCTGACAAAGTCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks