EMAIL THIS PAGE TO A FRIEND

CAPN1

calpain 1, (mu/I) large subunit

85 Gene Product Result for
Synonyms: CANP CANP1 CANPL1 muCANP muCL
UniProtKB ID: P07384, Q2TTR0, Q6DHV4
Gene ID:
Human(823) Summary: The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(12333) calpain 1
Rat(29153) calpain 1, (mu/I) large subunit
chicken(396240) calpain 1, (mu/I) large subunit
cow(281661) calpain 1, (mu/I) large subunit
chicken(693249) calpain 1, (mu/I) large subunit
domestic cat(101096916) calpain 1, (mu/I) large subunit
dog(483745) calpain 1, (mu/I) large subunit
Goat(100861313) calpain 1, (mu/I) large subunit
Domestic Rabbit(100009089) calpain 1, (mu/I) large subunit
sheep(443130) calpain 1, (mu/I) large subunit
domestic guinea pig(100726550) calpain 1, (mu/I) large subunit
naked mole-rat(101696511) calpain 1, (mu/I) large subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005186 Rosetta Predictions human pricing
NM_019152 Rosetta Predictions rat pricing
NM_001110504 Rosetta Predictions mouse pricing
NM_007600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237346 predicted 1075
2 SASI_Hs01_00237348 predicted 1457
3 SASI_Hs01_00237349 predicted 1842
4 SASI_Hs01_00237350 predicted 1155
5 SASI_Hs01_00237351 predicted 1995
6 SASI_Hs02_00339133 predicted 1763
7 SASI_Hs01_00237352 predicted 2066
8 SASI_Hs02_00339134 predicted 366
9 SASI_Hs01_00237353 predicted 2152
10 SASI_Hs01_00237354 predicted 643
11 SASI_Hs01_00237347 predicted 2243
12 SASI_Hs01_00237355 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051644 predicted 2140
2 SASI_Rn01_00051645 predicted 2170
3 SASI_Rn01_00051646 predicted 1732
4 SASI_Rn01_00051647 predicted 1203
5 SASI_Rn01_00051648 predicted 648
6 SASI_Rn01_00051649 predicted 1562
7 SASI_Rn01_00051650 predicted 1442
8 SASI_Rn01_00051651 predicted 1102
9 SASI_Rn01_00051652 predicted 1115
10 SASI_Rn01_00051653 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305578 predicted 1472
2 SASI_Mm02_00305579 predicted 1829
3 SASI_Mm02_00305580 predicted 1242
4 SASI_Mm02_00305581 predicted 2175
5 SASI_Mm02_00305582 predicted 1809
6 SASI_Mm02_00305583 predicted 1104
7 SASI_Mm02_00305584 predicted 1711
8 SASI_Mm02_00305585 predicted 1788
9 SASI_Mm02_00305586 predicted 1145
10 SASI_Mm02_00305587 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161326 predicted 1518
2 SASI_Mm01_00161327 predicted 1875
3 SASI_Mm01_00161328 predicted 1291
4 SASI_Mm01_00161329 predicted 2228
5 SASI_Mm01_00161330 predicted 1861
6 SASI_Mm01_00161331 predicted 1160
7 SASI_Mm01_00161332 predicted 1758
8 SASI_Mm01_00161334 predicted 1841
9 SASI_Mm01_00161335 predicted 1196
10 SASI_Mm02_00312042 predicted 1203
11 SASI_Mm01_00161333 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005186
CAPN1 MISSION shRNA Bacterial Glycerol Stock
calpain 1, (mu/I) large subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005186.2-2649s21c1
Sequence:CCGGGCCTTGCCTGCAGACTATAAACTCGAGTTTATAGTCTGCAGGCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-1830s21c1
Sequence:CCGGGTGAAGGAGTTGCGGACAATCCTCGAGGATTGTCCGCAACTCCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-721s21c1
Sequence:CCGGAGGCCTATGCCAAGGTAAATGCTCGAGCATTTACCTTGGCATAGGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-591s21c1
Sequence:CCGGCATTTCCAGCTGTGGCAATTTCTCGAGAAATTGCCACAGCTGGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-1763s1c1
Sequence:CCGGAGAGGAGATTGACGAGAACTTCTCGAGAAGTTCTCGTCAATCTCCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-1451s1c1
Sequence:CCGGCGACATGGAGACTATTGGCTTCTCGAGAAGCCAATAGTCTCCATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005186.x-2895s1c1
Sequence:CCGGAGGGACTTGTGTACTGGTTATCTCGAGATAACCAGTACACAAGTCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-366s1c1
Sequence:CCGGCCCAATTCCTCCAAGACCTATCTCGAGATAGGTCTTGGAGGAATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-2187s1c1
Sequence:CCGGCTAGAGACCATGTTCCGATTTCTCGAGAAATCGGAACATGGTCTCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005186
CAPN1 MISSION shRNA shRNA Plasmid DNA
calpain 1, (mu/I) large subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005186.2-2649s21c1
Sequence:CCGGGCCTTGCCTGCAGACTATAAACTCGAGTTTATAGTCTGCAGGCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-1830s21c1
Sequence:CCGGGTGAAGGAGTTGCGGACAATCCTCGAGGATTGTCCGCAACTCCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-721s21c1
Sequence:CCGGAGGCCTATGCCAAGGTAAATGCTCGAGCATTTACCTTGGCATAGGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-591s21c1
Sequence:CCGGCATTTCCAGCTGTGGCAATTTCTCGAGAAATTGCCACAGCTGGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-1763s1c1
Sequence:CCGGAGAGGAGATTGACGAGAACTTCTCGAGAAGTTCTCGTCAATCTCCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-1451s1c1
Sequence:CCGGCGACATGGAGACTATTGGCTTCTCGAGAAGCCAATAGTCTCCATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005186.x-2895s1c1
Sequence:CCGGAGGGACTTGTGTACTGGTTATCTCGAGATAACCAGTACACAAGTCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-366s1c1
Sequence:CCGGCCCAATTCCTCCAAGACCTATCTCGAGATAGGTCTTGGAGGAATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-2187s1c1
Sequence:CCGGCTAGAGACCATGTTCCGATTTCTCGAGAAATCGGAACATGGTCTCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005186
CAPN1 MISSION shRNA Lentiviral Transduction Particles
calpain 1, (mu/I) large subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005186.2-2649s21c1
Sequence:CCGGGCCTTGCCTGCAGACTATAAACTCGAGTTTATAGTCTGCAGGCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-1830s21c1
Sequence:CCGGGTGAAGGAGTTGCGGACAATCCTCGAGGATTGTCCGCAACTCCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-721s21c1
Sequence:CCGGAGGCCTATGCCAAGGTAAATGCTCGAGCATTTACCTTGGCATAGGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005186.2-591s21c1
Sequence:CCGGCATTTCCAGCTGTGGCAATTTCTCGAGAAATTGCCACAGCTGGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-1763s1c1
Sequence:CCGGAGAGGAGATTGACGAGAACTTCTCGAGAAGTTCTCGTCAATCTCCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-1451s1c1
Sequence:CCGGCGACATGGAGACTATTGGCTTCTCGAGAAGCCAATAGTCTCCATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005186.x-2895s1c1
Sequence:CCGGAGGGACTTGTGTACTGGTTATCTCGAGATAACCAGTACACAAGTCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-366s1c1
Sequence:CCGGCCCAATTCCTCCAAGACCTATCTCGAGATAGGTCTTGGAGGAATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005186.x-2187s1c1
Sequence:CCGGCTAGAGACCATGTTCCGATTTCTCGAGAAATCGGAACATGGTCTCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007600
VALIDATED
CAPN1 MISSION shRNA Bacterial Glycerol Stock
calpain 1, (mu/I) large subunit
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000030664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-2587s1c1
Sequence:CCGGCGGATGTGAGTCTTGCCTAATCTCGAGATTAGGCAAGACTCACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-2060s1c1
Sequence:CCGGGCCGTGGACTTTGACAACTTTCTCGAGAAAGTTGTCAAAGTCCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007600.2-1147s1c1
Sequence:CCGGCCGGAATTGGAATACCACATTCTCGAGAATGTGGTATTCCAATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-807s1c1
Sequence:CCGGGCTCCATTAATATCTCCGATACTCGAGTATCGGAGATATTAATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007600
VALIDATED
CAPN1 MISSION shRNA shRNA Plasmid DNA
calpain 1, (mu/I) large subunit
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000030664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-2587s1c1
Sequence:CCGGCGGATGTGAGTCTTGCCTAATCTCGAGATTAGGCAAGACTCACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-2060s1c1
Sequence:CCGGGCCGTGGACTTTGACAACTTTCTCGAGAAAGTTGTCAAAGTCCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007600.2-1147s1c1
Sequence:CCGGCCGGAATTGGAATACCACATTCTCGAGAATGTGGTATTCCAATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-807s1c1
Sequence:CCGGGCTCCATTAATATCTCCGATACTCGAGTATCGGAGATATTAATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007600
VALIDATED
CAPN1 MISSION shRNA Lentiviral Transduction Particles
calpain 1, (mu/I) large subunit
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000030664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-2587s1c1
Sequence:CCGGCGGATGTGAGTCTTGCCTAATCTCGAGATTAGGCAAGACTCACATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-2060s1c1
Sequence:CCGGGCCGTGGACTTTGACAACTTTCTCGAGAAAGTTGTCAAAGTCCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007600.2-1147s1c1
Sequence:CCGGCCGGAATTGGAATACCACATTCTCGAGAATGTGGTATTCCAATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007600.2-807s1c1
Sequence:CCGGGCTCCATTAATATCTCCGATACTCGAGTATCGGAGATATTAATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)