EMAIL THIS PAGE TO A FRIEND

CAPN2

calpain 2, (m/II) large subunit

76 Gene Product Result for
Synonyms: CANP2 CANPL2 CANPml mCANP
Gene ID:
Human(824) Summary: The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(12334) calpain 2
Rat(29154) calpain 2, (m/II) large subunit
chicken(395963) calpain 2, (m/II) large subunit
domestic cat(101083231) calpain 2, (m/II) large subunit
cow(281662) calpain 2, (m/II) large subunit
Horse(100055184) calpain 2, (m/II) large subunit
dog(480118) calpain 2, (m/II) large subunit
domestic guinea pig(100725761) calpain 2, (m/II) large subunit
naked mole-rat(101720177) calpain 2, (m/II) large subunit
sheep(100127211) calpain 2, (m/II) large subunit
Domestic Rabbit(100009092) calpain 2, (m/II) large subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M6690 MDL 28170 ≥95% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001748 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001748 Rosetta Predictions human pricing
NM_017116 Rosetta Predictions rat pricing
NM_009794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059356 predicted 2234
2 SASI_Hs01_00059357 predicted 1053
3 SASI_Hs01_00059358 predicted 2285
4 SASI_Hs01_00059359 predicted 1867
5 SASI_Hs01_00059360 predicted 2105
6 SASI_Hs01_00059361 predicted 2345
7 SASI_Hs01_00059362 predicted 1893
8 SASI_Hs02_00332468 predicted 1793
9 SASI_Hs01_00059363 predicted 629
10 SASI_Hs01_00059365 predicted 2095
11 SASI_Hs01_00059364 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115456 predicted 2595
2 SASI_Rn01_00115457 predicted 2322
3 SASI_Rn01_00115458 predicted 2228
4 SASI_Rn01_00115459 predicted 1901
5 SASI_Rn02_00261353 predicted 2537
6 SASI_Rn01_00115460 predicted 1546
7 SASI_Rn01_00115461 predicted 1402
8 SASI_Rn01_00115462 predicted 1733
9 SASI_Rn02_00261354 predicted 1431
10 SASI_Rn01_00115463 predicted 1422
11 SASI_Rn01_00115464 predicted 2481
12 SASI_Rn01_00115465 predicted 2627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183460 predicted 1087
2 SASI_Mm01_00183461 predicted 1925
3 SASI_Mm01_00183462 predicted 1419
4 SASI_Mm01_00183463 predicted 1604
5 SASI_Mm01_00183464 predicted 1243
6 SASI_Mm01_00183465 predicted 1820
7 SASI_Mm01_00183466 predicted 1251
8 SASI_Mm01_00183467 predicted 2132
9 SASI_Mm02_00317057 predicted 2163
10 SASI_Mm01_00183468 predicted 1436
11 SASI_Mm01_00183469 predicted 2229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009794
VALIDATED
CAPN2 MISSION shRNA Bacterial Glycerol Stock
calpain 2, (m/II) large subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-1550s1c1
Sequence:CCGGGCGGTCAGATACCTTCATTAACTCGAGTTAATGAAGGTATCTGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-726s1c1
Sequence:CCGGGCCAAGATCAATGGGTGCTATCTCGAGATAGCACCCATTGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-508s1c1
Sequence:CCGGCCCTCACCTTGAATGAGGAAACTCGAGTTTCCTCATTCAAGGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-2126s1c1
Sequence:CCGGCGACGAGCTAATCATCGACTTCTCGAGAAGTCGATGATTAGCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-2171s1c1
Sequence:CCGGCCGTCTGGAAACGCTATTCAACTCGAGTTGAATAGCGTTTCCAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-2085s21c1
Sequence:CCGGCGACGAGCTAATCATCGACTTCTCGAGAAGTCGATGATTAGCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-685s21c1
Sequence:CCGGGCCAAGATCAATGGGTGCTATCTCGAGATAGCACCCATTGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-2130s21c1
Sequence:CCGGCCGTCTGGAAACGCTATTCAACTCGAGTTGAATAGCGTTTCCAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-467s21c1
Sequence:CCGGCCCTCACCTTGAATGAGGAAACTCGAGTTTCCTCATTCAAGGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-1509s21c1
Sequence:CCGGGCGGTCAGATACCTTCATTAACTCGAGTTAATGAAGGTATCTGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009794
VALIDATED
CAPN2 MISSION shRNA shRNA Plasmid DNA
calpain 2, (m/II) large subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-1550s1c1
Sequence:CCGGGCGGTCAGATACCTTCATTAACTCGAGTTAATGAAGGTATCTGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-726s1c1
Sequence:CCGGGCCAAGATCAATGGGTGCTATCTCGAGATAGCACCCATTGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-508s1c1
Sequence:CCGGCCCTCACCTTGAATGAGGAAACTCGAGTTTCCTCATTCAAGGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-2126s1c1
Sequence:CCGGCGACGAGCTAATCATCGACTTCTCGAGAAGTCGATGATTAGCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-2171s1c1
Sequence:CCGGCCGTCTGGAAACGCTATTCAACTCGAGTTGAATAGCGTTTCCAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-2085s21c1
Sequence:CCGGCGACGAGCTAATCATCGACTTCTCGAGAAGTCGATGATTAGCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-685s21c1
Sequence:CCGGGCCAAGATCAATGGGTGCTATCTCGAGATAGCACCCATTGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-2130s21c1
Sequence:CCGGCCGTCTGGAAACGCTATTCAACTCGAGTTGAATAGCGTTTCCAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-467s21c1
Sequence:CCGGCCCTCACCTTGAATGAGGAAACTCGAGTTTCCTCATTCAAGGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-1509s21c1
Sequence:CCGGGCGGTCAGATACCTTCATTAACTCGAGTTAATGAAGGTATCTGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009794
VALIDATED
CAPN2 MISSION shRNA Lentiviral Transduction Particles
calpain 2, (m/II) large subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-1550s1c1
Sequence:CCGGGCGGTCAGATACCTTCATTAACTCGAGTTAATGAAGGTATCTGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-726s1c1
Sequence:CCGGGCCAAGATCAATGGGTGCTATCTCGAGATAGCACCCATTGATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-508s1c1
Sequence:CCGGCCCTCACCTTGAATGAGGAAACTCGAGTTTCCTCATTCAAGGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-2126s1c1
Sequence:CCGGCGACGAGCTAATCATCGACTTCTCGAGAAGTCGATGATTAGCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009794.1-2171s1c1
Sequence:CCGGCCGTCTGGAAACGCTATTCAACTCGAGTTGAATAGCGTTTCCAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-2085s21c1
Sequence:CCGGCGACGAGCTAATCATCGACTTCTCGAGAAGTCGATGATTAGCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-685s21c1
Sequence:CCGGGCCAAGATCAATGGGTGCTATCTCGAGATAGCACCCATTGATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-2130s21c1
Sequence:CCGGCCGTCTGGAAACGCTATTCAACTCGAGTTGAATAGCGTTTCCAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-467s21c1
Sequence:CCGGCCCTCACCTTGAATGAGGAAACTCGAGTTTCCTCATTCAAGGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009794.3-1509s21c1
Sequence:CCGGGCGGTCAGATACCTTCATTAACTCGAGTTAATGAAGGTATCTGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001748
VALIDATED
CAPN2 MISSION shRNA Bacterial Glycerol Stock
calpain 2, (m/II) large subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-1522s1c1
Sequence:CCGGGCGCTCAGACACCTTCATCAACTCGAGTTGATGAAGGTGTCTGAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-2183s1c1
Sequence:CCGGCCCGAGAATACTGGAACAATACTCGAGTATTGTTCCAGTATTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001748.x-2028s1c1
Sequence:CCGGAGGCATTAGAAGAAGCAGGTTCTCGAGAACCTGCTTCTTCTAATGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-1264s1c1
Sequence:CCGGCAGGAACTACCCGAACACATTCTCGAGAATGTGTTCGGGTAGTTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001748.x-3273s1c1
Sequence:CCGGCGGTTTATGAGCACACAATTACTCGAGTAATTGTGTGCTCATAAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1961s21c1
Sequence:CCGGTATGGTTGACATGCTAGATTCCTCGAGGAATCTAGCATGTCAACCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1604s21c1
Sequence:CCGGGCGCTCAGACACCTTCATCAACTCGAGTTGATGAAGGTGTCTGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-2377s21c1
Sequence:CCGGGGACTAAGCTTCCATAGAAATCTCGAGATTTCTATGGAAGCTTAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-2265s21c1
Sequence:CCGGCCCGAGAATACTGGAACAATACTCGAGTATTGTTCCAGTATTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1346s21c1
Sequence:CCGGCAGGAACTACCCGAACACATTCTCGAGAATGTGTTCGGGTAGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001748
VALIDATED
CAPN2 MISSION shRNA shRNA Plasmid DNA
calpain 2, (m/II) large subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-1522s1c1
Sequence:CCGGGCGCTCAGACACCTTCATCAACTCGAGTTGATGAAGGTGTCTGAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-2183s1c1
Sequence:CCGGCCCGAGAATACTGGAACAATACTCGAGTATTGTTCCAGTATTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001748.x-2028s1c1
Sequence:CCGGAGGCATTAGAAGAAGCAGGTTCTCGAGAACCTGCTTCTTCTAATGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-1264s1c1
Sequence:CCGGCAGGAACTACCCGAACACATTCTCGAGAATGTGTTCGGGTAGTTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001748.x-3273s1c1
Sequence:CCGGCGGTTTATGAGCACACAATTACTCGAGTAATTGTGTGCTCATAAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1961s21c1
Sequence:CCGGTATGGTTGACATGCTAGATTCCTCGAGGAATCTAGCATGTCAACCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1604s21c1
Sequence:CCGGGCGCTCAGACACCTTCATCAACTCGAGTTGATGAAGGTGTCTGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-2377s21c1
Sequence:CCGGGGACTAAGCTTCCATAGAAATCTCGAGATTTCTATGGAAGCTTAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-2265s21c1
Sequence:CCGGCCCGAGAATACTGGAACAATACTCGAGTATTGTTCCAGTATTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1346s21c1
Sequence:CCGGCAGGAACTACCCGAACACATTCTCGAGAATGTGTTCGGGTAGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001748
VALIDATED
CAPN2 MISSION shRNA Lentiviral Transduction Particles
calpain 2, (m/II) large subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-1522s1c1
Sequence:CCGGGCGCTCAGACACCTTCATCAACTCGAGTTGATGAAGGTGTCTGAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-2183s1c1
Sequence:CCGGCCCGAGAATACTGGAACAATACTCGAGTATTGTTCCAGTATTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001748.x-2028s1c1
Sequence:CCGGAGGCATTAGAAGAAGCAGGTTCTCGAGAACCTGCTTCTTCTAATGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001748.x-1264s1c1
Sequence:CCGGCAGGAACTACCCGAACACATTCTCGAGAATGTGTTCGGGTAGTTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001748.x-3273s1c1
Sequence:CCGGCGGTTTATGAGCACACAATTACTCGAGTAATTGTGTGCTCATAAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1961s21c1
Sequence:CCGGTATGGTTGACATGCTAGATTCCTCGAGGAATCTAGCATGTCAACCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1604s21c1
Sequence:CCGGGCGCTCAGACACCTTCATCAACTCGAGTTGATGAAGGTGTCTGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-2377s21c1
Sequence:CCGGGGACTAAGCTTCCATAGAAATCTCGAGATTTCTATGGAAGCTTAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-2265s21c1
Sequence:CCGGCCCGAGAATACTGGAACAATACTCGAGTATTGTTCCAGTATTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001748.4-1346s21c1
Sequence:CCGGCAGGAACTACCCGAACACATTCTCGAGAATGTGTTCGGGTAGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)