EMAIL THIS PAGE TO A FRIEND

CAPN3

calpain 3, (p94)

269 Gene Product Result for
Synonyms: CANP3 CANPL3 LGMD2 LGMD2A nCL-1 p94
Gene ID:
Human(825) Summary: Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
Mouse(12335) calpain 3
Rat(29155) calpain 3
chicken(423233) calpain 3, (p94)
domestic cat(101081304) calpain 3, (p94)
cow(281663) calpain 3, (p94)
dog(487518) calpain 3, (p94)
sheep(443038) calpain 3, (p94)
Domestic Rabbit(100008726) calpain 3, (p94)
naked mole-rat(101707543) calpain 3, (p94)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C0603 Anti-Calpain LP-82/LP-85 (Lens-Specific Calpain) (Domain III), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution rat
western blot pricing
C0478 Anti-Calpain LP-85 (Lens-Specific Calpain) (Domain IV), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse
western blot pricing
C3239 Anti-Calpain-94 (Catalytic Domain), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
C3364 Anti-Calpain-94 (Domain II), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human, rat
western blot pricing
C6361 Anti-Calpain-94 (Domain II, Insert 1), Large Subunit antibody produced in rabbit ~1 mg/mL, buffered aqueous glycerol solution, affinity isolated antibody human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
HPA040052 Anti-CAPN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
C0728 Anti-m-Calpain (Domain III), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
western blot pricing
SAB1402710 Monoclonal Anti-CAPN3, (C-terminal) antibody produced in mouse clone 1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099991 MISSION® esiRNA esiRNA human CAPN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000070 Rosetta Predictions human pricing
NM_024344 Rosetta Predictions human pricing
NM_173087 Rosetta Predictions human pricing
NM_173088 Rosetta Predictions human pricing
NM_173089 Rosetta Predictions human pricing
NM_173090 Rosetta Predictions human pricing
NM_212464 Rosetta Predictions human pricing
NM_212465 Rosetta Predictions human pricing
NM_212467 Rosetta Predictions human pricing
NM_017117 Rosetta Predictions rat pricing
NM_001109761 Rosetta Predictions mouse pricing
NM_007601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301794 predicted 2711
2 SASI_Hs02_00301795 predicted 2998
3 SASI_Hs01_00169073 predicted 2470
4 SASI_Hs02_00301796 predicted 2712
5 SASI_Hs02_00301797 predicted 2792
6 SASI_Hs01_00169076 predicted 2532
7 SASI_Hs02_00301798 predicted 2745
8 SASI_Hs01_00169077 predicted 2530
9 SASI_Hs02_00301799 predicted 2986
10 SASI_Hs02_00301800 predicted 2942
11 SASI_Hs01_00169074 predicted 2629
12 SASI_Hs01_00169075 predicted 2617
13 SASI_Hs01_00169078 predicted 2593
14 SASI_Hs01_00169079 predicted 2462
15 SASI_Hs01_00169080 predicted 2553
16 SASI_Hs01_00169081 predicted 2511
17 SASI_Hs01_00169082 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356696 predicted 2688
2 SASI_Hs02_00356697 predicted 2980
3 SASI_Hs01_00081124 predicted 2452
4 SASI_Hs02_00356698 predicted 2688
5 SASI_Hs02_00356699 predicted 2773
6 SASI_Hs01_00081127 predicted 2508
7 SASI_Hs02_00356700 predicted 2725
8 SASI_Hs01_00081128 predicted 2513
9 SASI_Hs02_00356701 predicted 2973
10 SASI_Hs02_00356702 predicted 2927
11 SASI_Hs01_00081125 predicted 2619
12 SASI_Hs01_00081126 predicted 2600
13 SASI_Hs01_00081129 predicted 2573
14 SASI_Hs01_00081130 predicted 2446
15 SASI_Hs01_00081131 predicted 2540
16 SASI_Hs01_00081132 predicted 2494
17 SASI_Hs01_00081133 predicted 2410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368088 predicted 2430
2 SASI_Hs02_00368089 predicted 2714
3 SASI_Hs01_00131655 predicted 2189
4 SASI_Hs02_00368090 predicted 2435
5 SASI_Hs02_00368091 predicted 2522
6 SASI_Hs01_00131658 predicted 2257
7 SASI_Hs02_00368092 predicted 2469
8 SASI_Hs01_00131659 predicted 2261
9 SASI_Hs02_00368093 predicted 2716
10 SASI_Hs02_00368094 predicted 2665
11 SASI_Hs01_00131656 predicted 2353
12 SASI_Hs01_00131657 predicted 2342
13 SASI_Hs01_00131660 predicted 2311
14 SASI_Hs01_00131661 predicted 2181
15 SASI_Hs01_00131662 predicted 2282
16 SASI_Hs01_00131663 predicted 2237
17 SASI_Hs01_00131664 predicted 2149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368095 predicted 1037
2 SASI_Hs02_00368096 predicted 1322
3 SASI_Hs01_00129016 predicted 801
4 SASI_Hs02_00368097 predicted 1037
5 SASI_Hs02_00368098 predicted 1118
6 SASI_Hs01_00129019 predicted 855
7 SASI_Hs02_00368099 predicted 1078
8 SASI_Hs01_00129020 predicted 864
9 SASI_Hs02_00368100 predicted 1319
10 SASI_Hs02_00368101 predicted 1272
11 SASI_Hs01_00129017 predicted 960
12 SASI_Hs01_00129018 predicted 942
13 SASI_Hs01_00129021 predicted 914
14 SASI_Hs01_00129022 predicted 784
15 SASI_Hs01_00129023 predicted 880
16 SASI_Hs01_00129024 predicted 846
17 SASI_Hs01_00129025 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368102 predicted 666
2 SASI_Hs02_00368103 predicted 949
3 SASI_Hs01_00173936 predicted 422
4 SASI_Hs02_00368104 predicted 665
5 SASI_Hs02_00368105 predicted 746
6 SASI_Hs01_00173939 predicted 486
7 SASI_Hs02_00368106 predicted 703
8 SASI_Hs01_00173940 predicted 493
9 SASI_Hs02_00368107 predicted 948
10 SASI_Hs02_00368108 predicted 899
11 SASI_Hs01_00173937 predicted 595
12 SASI_Hs01_00173938 predicted 575
13 SASI_Hs01_00173941 predicted 550
14 SASI_Hs01_00173942 predicted 416
15 SASI_Hs01_00173943 predicted 510
16 SASI_Hs01_00173944 predicted 475
17 SASI_Hs01_00173945 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368109 predicted 679
2 SASI_Hs02_00368110 predicted 968
3 SASI_Hs01_00219268 predicted 444
4 SASI_Hs02_00368111 predicted 685
5 SASI_Hs02_00368112 predicted 768
6 SASI_Hs01_00219271 predicted 508
7 SASI_Hs02_00368113 predicted 724
8 SASI_Hs01_00219272 predicted 506
9 SASI_Hs02_00368114 predicted 966
10 SASI_Hs02_00368115 predicted 920
11 SASI_Hs01_00219269 predicted 613
12 SASI_Hs01_00219270 predicted 592
13 SASI_Hs01_00219273 predicted 569
14 SASI_Hs01_00219274 predicted 438
15 SASI_Hs01_00219275 predicted 533
16 SASI_Hs01_00219276 predicted 495
17 SASI_Hs01_00219277 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165626 predicted 1092
2 SASI_Hs01_00165627 predicted 1744
3 SASI_Hs01_00165628 predicted 1568
4 SASI_Hs01_00165629 predicted 774
5 SASI_Hs01_00165631 predicted 1354
6 SASI_Hs01_00165632 predicted 1636
7 SASI_Hs01_00165633 predicted 963
8 SASI_Hs01_00165634 predicted 1322
9 SASI_Hs01_00165635 predicted 1048
10 SASI_Hs02_00374182 predicted 1261
11 SASI_Hs01_00165630 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374183 predicted 2618
2 SASI_Hs02_00374184 predicted 2897
3 SASI_Hs01_00022402 predicted 2374
4 SASI_Hs02_00374185 predicted 2619
5 SASI_Hs02_00374186 predicted 2701
6 SASI_Hs01_00022405 predicted 2437
7 SASI_Hs02_00374187 predicted 2653
8 SASI_Hs01_00022406 predicted 2438
9 SASI_Hs02_00374188 predicted 2898
10 SASI_Hs02_00374189 predicted 2850
11 SASI_Hs01_00022403 predicted 2547
12 SASI_Hs01_00022404 predicted 2525
13 SASI_Hs01_00022407 predicted 2504
14 SASI_Hs01_00022408 predicted 2365
15 SASI_Hs01_00022409 predicted 2468
16 SASI_Hs01_00022410 predicted 2427
17 SASI_Hs01_00022411 predicted 2334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127458 predicted 1081
2 SASI_Hs01_00127459 predicted 1052
3 SASI_Hs01_00127460 predicted 1234
4 SASI_Hs01_00127462 predicted 1113
5 SASI_Hs01_00127463 predicted 1240
6 SASI_Hs01_00127464 predicted 1133
7 SASI_Hs01_00127465 predicted 583
8 SASI_Hs01_00127466 predicted 953
9 SASI_Hs01_00127467 predicted 1293
10 SASI_Hs02_00374190 predicted 1120
11 SASI_Hs01_00127461 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261355 predicted 485
2 SASI_Rn01_00064582 predicted 2425
3 SASI_Rn01_00064583 predicted 1482
4 SASI_Rn01_00064584 predicted 1295
5 SASI_Rn01_00064585 predicted 2389
6 SASI_Rn01_00064586 predicted 1638
7 SASI_Rn02_00261356 predicted 1826
8 SASI_Rn01_00064588 predicted 2505
9 SASI_Rn01_00064589 predicted 474
10 SASI_Rn01_00064590 predicted 2627
11 SASI_Rn01_00064587 predicted 1817
12 SASI_Rn01_00064591 predicted 2742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304334 predicted 2209
2 SASI_Mm02_00304335 predicted 1940
3 SASI_Mm02_00304336 predicted 1862
4 SASI_Mm02_00304337 predicted 1381
5 SASI_Mm02_00304338 predicted 2221
6 SASI_Mm02_00304339 predicted 1393
7 SASI_Mm02_00304340 predicted 1391
8 SASI_Mm02_00304341 predicted 1044
9 SASI_Mm02_00304342 predicted 1063
10 SASI_Mm02_00304343 predicted 2067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312043 predicted 2755
2 SASI_Mm01_00128796 predicted 2485
3 SASI_Mm01_00128798 predicted 2408
4 SASI_Mm01_00128799 predicted 1793
5 SASI_Mm02_00312044 predicted 2765
6 SASI_Mm01_00128801 predicted 1806
7 SASI_Mm02_00312045 predicted 1805
8 SASI_Mm01_00128802 predicted 1462
9 SASI_Mm01_00128804 predicted 1470
10 SASI_Mm02_00312046 predicted 2605
11 SASI_Mm01_00128797 predicted 736
12 SASI_Mm01_00128800 predicted 2102
13 SASI_Mm01_00128803 predicted 207
14 SASI_Mm01_00128805 predicted 1001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000070
CAPN3 MISSION shRNA Bacterial Glycerol Stock
calpain 3, (p94)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000070.2-1719s21c1
Sequence:CCGGTGATGACTCGGAGGTGATTTGCTCGAGCAAATCACCTCCGAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-1173s1c1
Sequence:CCGGGATGGTAAGGAATATGGATAACTCGAGTTATCCATATTCCTTACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-468s1c1
Sequence:CCGGCGGAGTGAAAGAGAAGACATTCTCGAGAATGTCTTCTCTTTCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000070.x-3063s1c1
Sequence:CCGGGCTCCTGCTTACCTTGCTCTACTCGAGTAGAGCAAGGTAAGCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-2574s1c1
Sequence:CCGGCCACCTCAACAACCAGCTCTACTCGAGTAGAGCTGGTTGTTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003493    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000070-1647s1c1
Sequence:CCGGCCGCAACTTCCCAGATACTTTCTCGAGAAAGTATCTGGGAAGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000070
CAPN3 MISSION shRNA shRNA Plasmid DNA
calpain 3, (p94)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000070.2-1719s21c1
Sequence:CCGGTGATGACTCGGAGGTGATTTGCTCGAGCAAATCACCTCCGAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-1173s1c1
Sequence:CCGGGATGGTAAGGAATATGGATAACTCGAGTTATCCATATTCCTTACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-468s1c1
Sequence:CCGGCGGAGTGAAAGAGAAGACATTCTCGAGAATGTCTTCTCTTTCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000070.x-3063s1c1
Sequence:CCGGGCTCCTGCTTACCTTGCTCTACTCGAGTAGAGCAAGGTAAGCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-2574s1c1
Sequence:CCGGCCACCTCAACAACCAGCTCTACTCGAGTAGAGCTGGTTGTTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003493    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000070-1647s1c1
Sequence:CCGGCCGCAACTTCCCAGATACTTTCTCGAGAAAGTATCTGGGAAGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000070
CAPN3 MISSION shRNA Lentiviral Transduction Particles
calpain 3, (p94)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000070.2-1719s21c1
Sequence:CCGGTGATGACTCGGAGGTGATTTGCTCGAGCAAATCACCTCCGAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-1173s1c1
Sequence:CCGGGATGGTAAGGAATATGGATAACTCGAGTTATCCATATTCCTTACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-468s1c1
Sequence:CCGGCGGAGTGAAAGAGAAGACATTCTCGAGAATGTCTTCTCTTTCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000070.x-3063s1c1
Sequence:CCGGGCTCCTGCTTACCTTGCTCTACTCGAGTAGAGCAAGGTAAGCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000070.x-2574s1c1
Sequence:CCGGCCACCTCAACAACCAGCTCTACTCGAGTAGAGCTGGTTGTTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003493    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000070-1647s1c1
Sequence:CCGGCCGCAACTTCCCAGATACTTTCTCGAGAAAGTATCTGGGAAGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007601
CAPN3 MISSION shRNA Bacterial Glycerol Stock
calpain 3, (p94)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-956s1c1
Sequence:CCGGCGGTGCAGTATGAAACAAGAACTCGAGTTCTTGTTTCATACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-122s1c1
Sequence:CCGGGCATCTATTCAGCTATCATTACTCGAGTAATGATAGCTGAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-1529s1c1
Sequence:CCGGCCAAAGAGATGCACGGGAATACTCGAGTATTCCCGTGCATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-304s1c1
Sequence:CCGGCCTCCGGAAATTTGTGAGAATCTCGAGATTCTCACAAATTTCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-2096s1c1
Sequence:CCGGGCATGATAGCTCTCATGGATACTCGAGTATCCATGAGAGCTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007601
CAPN3 MISSION shRNA shRNA Plasmid DNA
calpain 3, (p94)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-956s1c1
Sequence:CCGGCGGTGCAGTATGAAACAAGAACTCGAGTTCTTGTTTCATACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-122s1c1
Sequence:CCGGGCATCTATTCAGCTATCATTACTCGAGTAATGATAGCTGAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-1529s1c1
Sequence:CCGGCCAAAGAGATGCACGGGAATACTCGAGTATTCCCGTGCATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-304s1c1
Sequence:CCGGCCTCCGGAAATTTGTGAGAATCTCGAGATTCTCACAAATTTCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-2096s1c1
Sequence:CCGGGCATGATAGCTCTCATGGATACTCGAGTATCCATGAGAGCTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007601
CAPN3 MISSION shRNA Lentiviral Transduction Particles
calpain 3, (p94)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-956s1c1
Sequence:CCGGCGGTGCAGTATGAAACAAGAACTCGAGTTCTTGTTTCATACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-122s1c1
Sequence:CCGGGCATCTATTCAGCTATCATTACTCGAGTAATGATAGCTGAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-1529s1c1
Sequence:CCGGCCAAAGAGATGCACGGGAATACTCGAGTATTCCCGTGCATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-304s1c1
Sequence:CCGGCCTCCGGAAATTTGTGAGAATCTCGAGATTCTCACAAATTTCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007601.1-2096s1c1
Sequence:CCGGGCATGATAGCTCTCATGGATACTCGAGTATCCATGAGAGCTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks