EMAIL THIS PAGE TO A FRIEND

CAPN5

calpain 5

51 Gene Product Result for
Synonyms: HTRA3 nCL-3
UniProtKB ID: O15484, O00263
Gene ID:
Human(726) Summary: Calpains are calcium-dependent cysteine proteases involved in signal transduction in a variety of cellular processes. A functional calpain protein consists of an invariant small subunit and 1 of a family of large subunits. CAPN5 is one of the large subunits. Unlike some of the calpains, CAPN5 and CAPN6 lack a calmodulin-like domain IV. Because of the significant similarity to Caenorhabditis elegans sex determination gene tra-3, CAPN5 is also called as HTRA3. [provided by RefSeq, Jul 2008]
Mouse(12337) calpain 5
Rat(171495) calpain 5
chicken(419086) calpain 5
Horse(100063478) calpain 5
cow(536988) calpain 5
dog(485175) calpain 5
sheep(101113269) calpain 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004055 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063071 MISSION® esiRNA esiRNA human CAPN5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004055 Rosetta Predictions human pricing
NM_134461 Rosetta Predictions rat pricing
NM_007602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203685 predicted 1785
2 SASI_Hs01_00203686 predicted 1349
3 SASI_Hs01_00203687 predicted 618
4 SASI_Hs01_00203688 predicted 788
5 SASI_Hs01_00203689 predicted 1011
6 SASI_Hs01_00203690 predicted 823
7 SASI_Hs01_00203692 predicted 746
8 SASI_Hs01_00203693 predicted 607
9 SASI_Hs01_00203694 predicted 920
10 SASI_Hs02_00336826 predicted 365
11 SASI_Hs01_00203691 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064059 predicted 1106
2 SASI_Rn01_00064060 predicted 1060
3 SASI_Rn01_00064061 predicted 1268
4 SASI_Rn01_00064062 predicted 1721
5 SASI_Rn01_00064063 predicted 1085
6 SASI_Rn01_00064064 predicted 525
7 SASI_Rn01_00064065 predicted 1094
8 SASI_Rn01_00064066 predicted 1264
9 SASI_Rn01_00064067 predicted 1093
10 SASI_Rn01_00064068 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089526 predicted 1169
2 SASI_Mm01_00089527 predicted 424
3 SASI_Mm01_00089528 predicted 1370
4 SASI_Mm01_00089529 predicted 1795
5 SASI_Mm01_00089530 predicted 600
6 SASI_Mm01_00089531 predicted 1781
7 SASI_Mm01_00089532 predicted 1901
8 SASI_Mm01_00089533 predicted 850
9 SASI_Mm01_00089534 predicted 1367
10 SASI_Mm01_00089535 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007602
VALIDATED
CAPN5 MISSION shRNA Bacterial Glycerol Stock
calpain 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007602.2-1173s1c1
Sequence:CCGGCCGGTACTTTACTGACATCATCTCGAGATGATGTCAGTAAAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007602.2-1519s1c1
Sequence:CCGGGCCAGCTCCATCTACATCAATCTCGAGATTGATGTAGATGGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-618s1c1
Sequence:CCGGGCTCATTTACTGCCATTCCAACTCGAGTTGGAATGGCAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-805s1c1
Sequence:CCGGGCTAAGAGGAATCAGCTCTTTCTCGAGAAAGAGCTGATTCCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-1932s1c1
Sequence:CCGGCCGAGTCCTGAAGGATGAATTCTCGAGAATTCATCCTTCAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-618s21c1
Sequence:CCGGGCTCATTTACTGCCATTCCAACTCGAGTTGGAATGGCAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-805s21c1
Sequence:CCGGGCTAAGAGGAATCAGCTCTTTCTCGAGAAAGAGCTGATTCCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1519s21c1
Sequence:CCGGGCCAGCTCCATCTACATCAATCTCGAGATTGATGTAGATGGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1932s21c1
Sequence:CCGGCCGAGTCCTGAAGGATGAATTCTCGAGAATTCATCCTTCAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1173s21c1
Sequence:CCGGCCGGTACTTTACTGACATCATCTCGAGATGATGTCAGTAAAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007602
VALIDATED
CAPN5 MISSION shRNA shRNA Plasmid DNA
calpain 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007602.2-1173s1c1
Sequence:CCGGCCGGTACTTTACTGACATCATCTCGAGATGATGTCAGTAAAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007602.2-1519s1c1
Sequence:CCGGGCCAGCTCCATCTACATCAATCTCGAGATTGATGTAGATGGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-618s1c1
Sequence:CCGGGCTCATTTACTGCCATTCCAACTCGAGTTGGAATGGCAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-805s1c1
Sequence:CCGGGCTAAGAGGAATCAGCTCTTTCTCGAGAAAGAGCTGATTCCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-1932s1c1
Sequence:CCGGCCGAGTCCTGAAGGATGAATTCTCGAGAATTCATCCTTCAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-618s21c1
Sequence:CCGGGCTCATTTACTGCCATTCCAACTCGAGTTGGAATGGCAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-805s21c1
Sequence:CCGGGCTAAGAGGAATCAGCTCTTTCTCGAGAAAGAGCTGATTCCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1519s21c1
Sequence:CCGGGCCAGCTCCATCTACATCAATCTCGAGATTGATGTAGATGGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1932s21c1
Sequence:CCGGCCGAGTCCTGAAGGATGAATTCTCGAGAATTCATCCTTCAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1173s21c1
Sequence:CCGGCCGGTACTTTACTGACATCATCTCGAGATGATGTCAGTAAAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007602
VALIDATED
CAPN5 MISSION shRNA Lentiviral Transduction Particles
calpain 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007602.2-1173s1c1
Sequence:CCGGCCGGTACTTTACTGACATCATCTCGAGATGATGTCAGTAAAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007602.2-1519s1c1
Sequence:CCGGGCCAGCTCCATCTACATCAATCTCGAGATTGATGTAGATGGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-618s1c1
Sequence:CCGGGCTCATTTACTGCCATTCCAACTCGAGTTGGAATGGCAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-805s1c1
Sequence:CCGGGCTAAGAGGAATCAGCTCTTTCTCGAGAAAGAGCTGATTCCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007602.2-1932s1c1
Sequence:CCGGCCGAGTCCTGAAGGATGAATTCTCGAGAATTCATCCTTCAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-618s21c1
Sequence:CCGGGCTCATTTACTGCCATTCCAACTCGAGTTGGAATGGCAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-805s21c1
Sequence:CCGGGCTAAGAGGAATCAGCTCTTTCTCGAGAAAGAGCTGATTCCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1519s21c1
Sequence:CCGGGCCAGCTCCATCTACATCAATCTCGAGATTGATGTAGATGGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1932s21c1
Sequence:CCGGCCGAGTCCTGAAGGATGAATTCTCGAGAATTCATCCTTCAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007602.3-1173s21c1
Sequence:CCGGCCGGTACTTTACTGACATCATCTCGAGATGATGTCAGTAAAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004055
CAPN5 MISSION shRNA Bacterial Glycerol Stock
calpain 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004055.3-2400s1c1
Sequence:CCGGGCCAAGAAGATGTCACTTGTTCTCGAGAACAAGTGACATCTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-803s1c1
Sequence:CCGGCAGCTCTTTGAGCGCATGTTACTCGAGTAACATGCGCTCAAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-1849s1c1
Sequence:CCGGGTACAATGTGAAAGGCATCTTCTCGAGAAGATGCCTTTCACATTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-1919s1c1
Sequence:CCGGCGAGTGCTGAAGGATGAATTTCTCGAGAAATTCATCCTTCAGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004055.4-2293s21c1
Sequence:CCGGCCATTCTCGTGGAGGAGTTTCCTCGAGGAAACTCCTCCACGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004055.4-1793s21c1
Sequence:CCGGTAACTCTTATGTGATCATCAACTCGAGTTGATGATCACATAAGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004055.4-2355s21c1
Sequence:CCGGCCACTGCTAAGGGACTCTATCCTCGAGGATAGAGTCCCTTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004055
CAPN5 MISSION shRNA shRNA Plasmid DNA
calpain 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004055.3-2400s1c1
Sequence:CCGGGCCAAGAAGATGTCACTTGTTCTCGAGAACAAGTGACATCTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-803s1c1
Sequence:CCGGCAGCTCTTTGAGCGCATGTTACTCGAGTAACATGCGCTCAAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-1849s1c1
Sequence:CCGGGTACAATGTGAAAGGCATCTTCTCGAGAAGATGCCTTTCACATTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-1919s1c1
Sequence:CCGGCGAGTGCTGAAGGATGAATTTCTCGAGAAATTCATCCTTCAGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004055.4-2293s21c1
Sequence:CCGGCCATTCTCGTGGAGGAGTTTCCTCGAGGAAACTCCTCCACGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004055.4-1793s21c1
Sequence:CCGGTAACTCTTATGTGATCATCAACTCGAGTTGATGATCACATAAGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004055.4-2355s21c1
Sequence:CCGGCCACTGCTAAGGGACTCTATCCTCGAGGATAGAGTCCCTTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004055
CAPN5 MISSION shRNA Lentiviral Transduction Particles
calpain 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004055.3-2400s1c1
Sequence:CCGGGCCAAGAAGATGTCACTTGTTCTCGAGAACAAGTGACATCTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-803s1c1
Sequence:CCGGCAGCTCTTTGAGCGCATGTTACTCGAGTAACATGCGCTCAAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-1849s1c1
Sequence:CCGGGTACAATGTGAAAGGCATCTTCTCGAGAAGATGCCTTTCACATTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004055.3-1919s1c1
Sequence:CCGGCGAGTGCTGAAGGATGAATTTCTCGAGAAATTCATCCTTCAGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004055.4-2293s21c1
Sequence:CCGGCCATTCTCGTGGAGGAGTTTCCTCGAGGAAACTCCTCCACGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004055.4-1793s21c1
Sequence:CCGGTAACTCTTATGTGATCATCAACTCGAGTTGATGATCACATAAGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004055.4-2355s21c1
Sequence:CCGGCCACTGCTAAGGGACTCTATCCTCGAGGATAGAGTCCCTTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks