EMAIL THIS PAGE TO A FRIEND

CAPN6

calpain 6

153 Gene Product Result for
Synonyms: CANPX CAPNX CalpM DJ914P14.1
UniProtKB ID: Q9Y6Q1, D3DUY7, Q9UEQ1, Q9UJA8
Gene ID:
Human(827) Summary: Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is highly expressed in the placenta. Its C-terminal region lacks any homology to the calmodulin-like domain of other calpains. The protein lacks critical active site residues and thus is suggested to be proteolytically inactive. The protein may play a role in tumor formation by inhibiting apoptosis and promoting angiogenesis. [provided by RefSeq, Nov 2009]
Mouse(12338) calpain 6
Rat(83685) calpain 6
chicken(422341) calpain 6
dog(492068) calpain 6
cow(539360) calpain 6
Horse(100054264) calpain 6
sheep(101110122) calpain 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014289 Rosetta Predictions human pricing
NM_031808 Rosetta Predictions rat pricing
XM_579535 Rosetta Predictions rat pricing
NM_007603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052068 predicted 1160
2 SASI_Hs02_00345376 predicted 2084
3 SASI_Hs02_00345377 predicted 740
4 SASI_Hs01_00052070 predicted 522
5 SASI_Hs02_00345378 predicted 1112
6 SASI_Hs01_00052071 predicted 920
7 SASI_Hs01_00052072 predicted 702
8 SASI_Hs01_00052073 predicted 1390
9 SASI_Hs01_00052074 predicted 987
10 SASI_Hs01_00052075 predicted 806
11 SASI_Hs01_00052069 predicted 535
12 SASI_Hs01_00052076 predicted 930
13 SASI_Hs01_00052077 predicted 2013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265264 predicted 867
2 SASI_Rn01_00065211 predicted 978
3 SASI_Rn01_00065212 predicted 1551
4 SASI_Rn01_00065213 predicted 658
5 SASI_Rn01_00065215 predicted 998
6 SASI_Rn01_00065216 predicted 1380
7 SASI_Rn01_00065217 predicted 751
8 SASI_Rn01_00065218 predicted 2128
9 SASI_Rn01_00065219 predicted 1147
10 SASI_Rn02_00265265 predicted 2148
11 SASI_Rn01_00065210 predicted 511
12 SASI_Rn01_00065214 predicted 1992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142381 predicted 512
2 SASI_Rn01_00142382 predicted 989
3 SASI_Rn01_00142383 predicted 1559
4 SASI_Rn01_00142384 predicted 663
5 SASI_Rn01_00142385 predicted 1990
6 SASI_Rn01_00142386 predicted 1004
7 SASI_Rn01_00142387 predicted 1380
8 SASI_Rn01_00142388 predicted 762
9 SASI_Rn01_00142389 predicted 2133
10 SASI_Rn01_00142390 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053980 predicted 1060
2 SASI_Mm01_00053981 predicted 1641
3 SASI_Mm01_00053982 predicted 1047
4 SASI_Mm01_00053983 predicted 1349
5 SASI_Mm01_00053984 predicted 1362
6 SASI_Mm01_00053985 predicted 2047
7 SASI_Mm01_00053986 predicted 1211
8 SASI_Mm01_00053987 predicted 719
9 SASI_Mm01_00053988 predicted 1152
10 SASI_Mm01_00053989 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014289
CAPN6 MISSION shRNA Bacterial Glycerol Stock
calpain 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-2071s21c1
Sequence:CCGGACATCAGCTTCAAGGTTATTTCTCGAGAAATAACCTTGAAGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-727s21c1
Sequence:CCGGGTTTGACCATCACTGATATTACTCGAGTAATATCAGTGATGGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-376s21c1
Sequence:CCGGATCTGATTGTGGGCAACATTACTCGAGTAATGTTGCCCACAATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1402s1c1
Sequence:CCGGCGAATGGGAAGACCTGACAATCTCGAGATTGTCAGGTCTTCCCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1753s1c1
Sequence:CCGGGAGAAGAAGTATGCCAATGAACTCGAGTTCATTGGCATACTTCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1983s1c1
Sequence:CCGGCCGTGATCTGAAGTCTCTGTACTCGAGTACAGAGACTTCAGATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014289.x-3001s1c1
Sequence:CCGGCCAGACATATTACAGCCAGTTCTCGAGAACTGGCTGTAATATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-473s1c1
Sequence:CCGGCCAACCATAAGGAACAGGAATCTCGAGATTCCTGTTCCTTATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014289
CAPN6 MISSION shRNA shRNA Plasmid DNA
calpain 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-2071s21c1
Sequence:CCGGACATCAGCTTCAAGGTTATTTCTCGAGAAATAACCTTGAAGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-727s21c1
Sequence:CCGGGTTTGACCATCACTGATATTACTCGAGTAATATCAGTGATGGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-376s21c1
Sequence:CCGGATCTGATTGTGGGCAACATTACTCGAGTAATGTTGCCCACAATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1402s1c1
Sequence:CCGGCGAATGGGAAGACCTGACAATCTCGAGATTGTCAGGTCTTCCCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1753s1c1
Sequence:CCGGGAGAAGAAGTATGCCAATGAACTCGAGTTCATTGGCATACTTCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1983s1c1
Sequence:CCGGCCGTGATCTGAAGTCTCTGTACTCGAGTACAGAGACTTCAGATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014289.x-3001s1c1
Sequence:CCGGCCAGACATATTACAGCCAGTTCTCGAGAACTGGCTGTAATATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-473s1c1
Sequence:CCGGCCAACCATAAGGAACAGGAATCTCGAGATTCCTGTTCCTTATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014289
CAPN6 MISSION shRNA Lentiviral Transduction Particles
calpain 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-2071s21c1
Sequence:CCGGACATCAGCTTCAAGGTTATTTCTCGAGAAATAACCTTGAAGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-727s21c1
Sequence:CCGGGTTTGACCATCACTGATATTACTCGAGTAATATCAGTGATGGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014289.3-376s21c1
Sequence:CCGGATCTGATTGTGGGCAACATTACTCGAGTAATGTTGCCCACAATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1402s1c1
Sequence:CCGGCGAATGGGAAGACCTGACAATCTCGAGATTGTCAGGTCTTCCCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1753s1c1
Sequence:CCGGGAGAAGAAGTATGCCAATGAACTCGAGTTCATTGGCATACTTCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-1983s1c1
Sequence:CCGGCCGTGATCTGAAGTCTCTGTACTCGAGTACAGAGACTTCAGATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014289.x-3001s1c1
Sequence:CCGGCCAGACATATTACAGCCAGTTCTCGAGAACTGGCTGTAATATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014289.x-473s1c1
Sequence:CCGGCCAACCATAAGGAACAGGAATCTCGAGATTCCTGTTCCTTATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007603
CAPN6 MISSION shRNA Bacterial Glycerol Stock
calpain 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007603.3-2550s21c1
Sequence:CCGGCCAGCTCCTAACTGACACTATCTCGAGATAGTGTCAGTTAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-559s21c1
Sequence:CCGGGCCAGAGAAATACGCTGGAATCTCGAGATTCCAGCGTATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-2035s21c1
Sequence:CCGGCCGTGATCTGAAATCTCTGTACTCGAGTACAGAGATTTCAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-320s21c1
Sequence:CCGGCCGGAGAATGATTCTCTGTTTCTCGAGAAACAGAGAATCATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007603.2-2451s1c1
Sequence:CCGGCCAGCTCCTAACTGACACTATCTCGAGATAGTGTCAGTTAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-1143s1c1
Sequence:CCGGGCAATGTGAATAATCCTGTTTCTCGAGAAACAGGATTATTCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-1936s1c1
Sequence:CCGGCCGTGATCTGAAATCTCTGTACTCGAGTACAGAGATTTCAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-460s1c1
Sequence:CCGGGCCAGAGAAATACGCTGGAATCTCGAGATTCCAGCGTATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-221s1c1
Sequence:CCGGCCGGAGAATGATTCTCTGTTTCTCGAGAAACAGAGAATCATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007603
CAPN6 MISSION shRNA shRNA Plasmid DNA
calpain 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007603.3-2550s21c1
Sequence:CCGGCCAGCTCCTAACTGACACTATCTCGAGATAGTGTCAGTTAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-559s21c1
Sequence:CCGGGCCAGAGAAATACGCTGGAATCTCGAGATTCCAGCGTATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-2035s21c1
Sequence:CCGGCCGTGATCTGAAATCTCTGTACTCGAGTACAGAGATTTCAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-320s21c1
Sequence:CCGGCCGGAGAATGATTCTCTGTTTCTCGAGAAACAGAGAATCATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007603.2-2451s1c1
Sequence:CCGGCCAGCTCCTAACTGACACTATCTCGAGATAGTGTCAGTTAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-1143s1c1
Sequence:CCGGGCAATGTGAATAATCCTGTTTCTCGAGAAACAGGATTATTCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-1936s1c1
Sequence:CCGGCCGTGATCTGAAATCTCTGTACTCGAGTACAGAGATTTCAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-460s1c1
Sequence:CCGGGCCAGAGAAATACGCTGGAATCTCGAGATTCCAGCGTATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-221s1c1
Sequence:CCGGCCGGAGAATGATTCTCTGTTTCTCGAGAAACAGAGAATCATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007603
CAPN6 MISSION shRNA Lentiviral Transduction Particles
calpain 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007603.3-2550s21c1
Sequence:CCGGCCAGCTCCTAACTGACACTATCTCGAGATAGTGTCAGTTAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-559s21c1
Sequence:CCGGGCCAGAGAAATACGCTGGAATCTCGAGATTCCAGCGTATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-2035s21c1
Sequence:CCGGCCGTGATCTGAAATCTCTGTACTCGAGTACAGAGATTTCAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007603.3-320s21c1
Sequence:CCGGCCGGAGAATGATTCTCTGTTTCTCGAGAAACAGAGAATCATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007603.2-2451s1c1
Sequence:CCGGCCAGCTCCTAACTGACACTATCTCGAGATAGTGTCAGTTAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-1143s1c1
Sequence:CCGGGCAATGTGAATAATCCTGTTTCTCGAGAAACAGGATTATTCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-1936s1c1
Sequence:CCGGCCGTGATCTGAAATCTCTGTACTCGAGTACAGAGATTTCAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-460s1c1
Sequence:CCGGGCCAGAGAAATACGCTGGAATCTCGAGATTCCAGCGTATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007603.2-221s1c1
Sequence:CCGGCCGGAGAATGATTCTCTGTTTCTCGAGAAACAGAGAATCATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks