EMAIL THIS PAGE TO A FRIEND

CAPN7

calpain 7

54 Gene Product Result for
Synonyms: CALPAIN7 PALBH
UniProtKB ID: Q9Y6W3
Gene ID:
Human(23473) Summary: Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
Mouse(12339) calpain 7
Rat(306260) calpain 7
sheep(101112192) calpain 7
Zebrafish(556792) calpain 7
dog(477062) calpain 7
cow(618048) calpain 7
Horse(100052592) calpain 7
chicken(420683) calpain 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014296 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014296 Rosetta Predictions human pricing
NM_001030037 Rosetta Predictions rat pricing
NM_009796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084244 predicted 802
2 SASI_Hs01_00084245 predicted 2156
3 SASI_Hs01_00084246 predicted 2407
4 SASI_Hs01_00084247 predicted 1484
5 SASI_Hs01_00084248 predicted 2441
6 SASI_Hs01_00084249 predicted 1162
7 SASI_Hs02_00345385 predicted 854
8 SASI_Hs01_00084250 predicted 1190
9 SASI_Hs01_00084251 predicted 1492
10 SASI_Hs01_00084253 predicted 1311
11 SASI_Hs01_00084252 predicted 2480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057802 predicted 2653
2 SASI_Rn01_00057803 predicted 1053
3 SASI_Rn01_00057804 predicted 954
4 SASI_Rn01_00057806 predicted 1195
5 SASI_Rn01_00057807 predicted 1736
6 SASI_Rn01_00057808 predicted 2423
7 SASI_Rn02_00203546 predicted 2359
8 SASI_Rn01_00057809 predicted 219
9 SASI_Rn01_00057810 predicted 2212
10 SASI_Rn02_00203547 predicted 986
11 SASI_Rn01_00057801 predicted 2138
12 SASI_Rn01_00057805 predicted 2064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081440 predicted 1199
2 SASI_Mm01_00081441 predicted 819
3 SASI_Mm01_00081443 predicted 2361
4 SASI_Mm01_00081444 predicted 2294
5 SASI_Mm01_00081446 predicted 1741
6 SASI_Mm02_00317062 predicted 1648
7 SASI_Mm01_00081447 predicted 2051
8 SASI_Mm01_00081448 predicted 693
9 SASI_Mm02_00317063 predicted 2368
10 SASI_Mm01_00081449 predicted 1054
11 SASI_Mm01_00081442 predicted 1787
12 SASI_Mm01_00081445 predicted 1941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009796
VALIDATED
CAPN7 MISSION shRNA Bacterial Glycerol Stock
calpain 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-2064s1c1
Sequence:CCGGCCTCATTACTTGACTAAGATACTCGAGTATCTTAGTCAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-1400s1c1
Sequence:CCGGCCAGACGTTCAGTAAGGATAACTCGAGTTATCCTTACTGAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009796.1-961s1c1
Sequence:CCGGCCAACAATCCTACAATGATATCTCGAGATATCATTGTAGGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-2301s1c1
Sequence:CCGGCCCATCTACCAATTCCATATACTCGAGTATATGGAATTGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009796.1-2031s1c1
Sequence:CCGGCCTCCATACATTGATGGGATTCTCGAGAATCCCATCAATGTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-961s21c1
Sequence:CCGGCCAACAATCCTACAATGATATCTCGAGATATCATTGTAGGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-2301s21c1
Sequence:CCGGCCCATCTACCAATTCCATATACTCGAGTATATGGAATTGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-1400s21c1
Sequence:CCGGCCAGACGTTCAGTAAGGATAACTCGAGTTATCCTTACTGAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-2064s21c1
Sequence:CCGGCCTCATTACTTGACTAAGATACTCGAGTATCTTAGTCAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009796
VALIDATED
CAPN7 MISSION shRNA shRNA Plasmid DNA
calpain 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-2064s1c1
Sequence:CCGGCCTCATTACTTGACTAAGATACTCGAGTATCTTAGTCAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-1400s1c1
Sequence:CCGGCCAGACGTTCAGTAAGGATAACTCGAGTTATCCTTACTGAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009796.1-961s1c1
Sequence:CCGGCCAACAATCCTACAATGATATCTCGAGATATCATTGTAGGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-2301s1c1
Sequence:CCGGCCCATCTACCAATTCCATATACTCGAGTATATGGAATTGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009796.1-2031s1c1
Sequence:CCGGCCTCCATACATTGATGGGATTCTCGAGAATCCCATCAATGTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-961s21c1
Sequence:CCGGCCAACAATCCTACAATGATATCTCGAGATATCATTGTAGGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-2301s21c1
Sequence:CCGGCCCATCTACCAATTCCATATACTCGAGTATATGGAATTGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-1400s21c1
Sequence:CCGGCCAGACGTTCAGTAAGGATAACTCGAGTTATCCTTACTGAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-2064s21c1
Sequence:CCGGCCTCATTACTTGACTAAGATACTCGAGTATCTTAGTCAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009796
VALIDATED
CAPN7 MISSION shRNA Lentiviral Transduction Particles
calpain 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-2064s1c1
Sequence:CCGGCCTCATTACTTGACTAAGATACTCGAGTATCTTAGTCAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-1400s1c1
Sequence:CCGGCCAGACGTTCAGTAAGGATAACTCGAGTTATCCTTACTGAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009796.1-961s1c1
Sequence:CCGGCCAACAATCCTACAATGATATCTCGAGATATCATTGTAGGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009796.1-2301s1c1
Sequence:CCGGCCCATCTACCAATTCCATATACTCGAGTATATGGAATTGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009796.1-2031s1c1
Sequence:CCGGCCTCCATACATTGATGGGATTCTCGAGAATCCCATCAATGTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-961s21c1
Sequence:CCGGCCAACAATCCTACAATGATATCTCGAGATATCATTGTAGGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-2301s21c1
Sequence:CCGGCCCATCTACCAATTCCATATACTCGAGTATATGGAATTGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-1400s21c1
Sequence:CCGGCCAGACGTTCAGTAAGGATAACTCGAGTTATCCTTACTGAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009796.2-2064s21c1
Sequence:CCGGCCTCATTACTTGACTAAGATACTCGAGTATCTTAGTCAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014296
VALIDATED
CAPN7 MISSION shRNA Bacterial Glycerol Stock
calpain 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014296.2-3262s1c1
Sequence:CCGGCCCAGGTGTTATGAAAGAATACTCGAGTATTCTTTCATAACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1205s1c1
Sequence:CCGGCCGGCATAATTTACCCTCAAACTCGAGTTTGAGGGTAAATTATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-2143s1c1
Sequence:CCGGCCTCCATACATTGATGGAATTCTCGAGAATTCCATCAATGTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1511s1c1
Sequence:CCGGGCCAAACTTTCAGTAAGGATACTCGAGTATCCTTACTGAAAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1680s1c1
Sequence:CCGGGCTGCGATTTATCCAGTTGAACTCGAGTTCAACTGGATAAATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-1511s21c1
Sequence:CCGGGCCAAACTTTCAGTAAGGATACTCGAGTATCCTTACTGAAAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-1680s21c1
Sequence:CCGGGCTGCGATTTATCCAGTTGAACTCGAGTTCAACTGGATAAATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-2267s21c1
Sequence:CCGGATTACACGGTTCGGGTATATTCTCGAGAATATACCCGAACCGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-3083s21c1
Sequence:CCGGGGAATAGTGGGCTAGATTAATCTCGAGATTAATCTAGCCCACTATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014296
VALIDATED
CAPN7 MISSION shRNA shRNA Plasmid DNA
calpain 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014296.2-3262s1c1
Sequence:CCGGCCCAGGTGTTATGAAAGAATACTCGAGTATTCTTTCATAACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1205s1c1
Sequence:CCGGCCGGCATAATTTACCCTCAAACTCGAGTTTGAGGGTAAATTATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-2143s1c1
Sequence:CCGGCCTCCATACATTGATGGAATTCTCGAGAATTCCATCAATGTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1511s1c1
Sequence:CCGGGCCAAACTTTCAGTAAGGATACTCGAGTATCCTTACTGAAAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1680s1c1
Sequence:CCGGGCTGCGATTTATCCAGTTGAACTCGAGTTCAACTGGATAAATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-1511s21c1
Sequence:CCGGGCCAAACTTTCAGTAAGGATACTCGAGTATCCTTACTGAAAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-1680s21c1
Sequence:CCGGGCTGCGATTTATCCAGTTGAACTCGAGTTCAACTGGATAAATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-2267s21c1
Sequence:CCGGATTACACGGTTCGGGTATATTCTCGAGAATATACCCGAACCGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-3083s21c1
Sequence:CCGGGGAATAGTGGGCTAGATTAATCTCGAGATTAATCTAGCCCACTATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014296
VALIDATED
CAPN7 MISSION shRNA Lentiviral Transduction Particles
calpain 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014296.2-3262s1c1
Sequence:CCGGCCCAGGTGTTATGAAAGAATACTCGAGTATTCTTTCATAACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1205s1c1
Sequence:CCGGCCGGCATAATTTACCCTCAAACTCGAGTTTGAGGGTAAATTATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-2143s1c1
Sequence:CCGGCCTCCATACATTGATGGAATTCTCGAGAATTCCATCAATGTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1511s1c1
Sequence:CCGGGCCAAACTTTCAGTAAGGATACTCGAGTATCCTTACTGAAAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014296.2-1680s1c1
Sequence:CCGGGCTGCGATTTATCCAGTTGAACTCGAGTTCAACTGGATAAATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-1511s21c1
Sequence:CCGGGCCAAACTTTCAGTAAGGATACTCGAGTATCCTTACTGAAAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-1680s21c1
Sequence:CCGGGCTGCGATTTATCCAGTTGAACTCGAGTTCAACTGGATAAATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-2267s21c1
Sequence:CCGGATTACACGGTTCGGGTATATTCTCGAGAATATACCCGAACCGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014296.2-3083s21c1
Sequence:CCGGGGAATAGTGGGCTAGATTAATCTCGAGATTAATCTAGCCCACTATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks