EMAIL THIS PAGE TO A FRIEND

CAPN8

calpain 8

96 Gene Product Result for
Synonyms: nCL-2
UniProtKB ID: A6NHC0, B2RXL2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141771 MISSION® esiRNA esiRNA human CAPN8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001128157 Rosetta Predictions human pricing
XM_001715299 Rosetta Predictions human pricing
XM_371344 Rosetta Predictions human pricing
XM_932638 Rosetta Predictions human pricing
XM_932643 Rosetta Predictions human pricing
XM_938885 Rosetta Predictions human pricing
NM_133309 Rosetta Predictions rat pricing
NM_130890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001128157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384517 predicted 1075
2 SASI_Hs02_00384518 predicted 579
3 SASI_Hs02_00384519 predicted 480
4 SASI_Hs02_00384520 predicted 739
5 SASI_Hs02_00384521 predicted 635
6 SASI_Hs02_00384522 predicted 733
7 SASI_Hs02_00384523 predicted 242
8 SASI_Hs02_00384524 predicted 1050
9 SASI_Hs02_00384525 predicted 831
10 SASI_Hs02_00384526 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402750 predicted 913
2 SASI_Hs02_00402751 predicted 1417
3 SASI_Hs02_00402752 predicted 1045
4 SASI_Hs02_00402753 predicted 480
5 SASI_Hs02_00402754 predicted 638
6 SASI_Hs02_00402755 predicted 733
7 SASI_Hs02_00402756 predicted 848
8 SASI_Hs02_00402757 predicted 498
9 SASI_Hs02_00402758 predicted 1065
10 SASI_Hs02_00402759 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288421 predicted 875
2 SASI_Hs01_00288422 predicted 808
3 SASI_Hs01_00288423 predicted 558
4 SASI_Hs01_00288424 predicted 838
5 SASI_Hs01_00288425 predicted 441
6 SASI_Hs01_00288426 predicted 598
7 SASI_Hs01_00288427 predicted 702
8 SASI_Hs01_00288428 predicted 208
9 SASI_Hs01_00288429 predicted 257
10 SASI_Hs01_00288430 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269428 predicted 744
2 SASI_Hs01_00269429 predicted 677
3 SASI_Hs01_00269430 predicted 413
4 SASI_Hs01_00269431 predicted 283
5 SASI_Hs01_00269432 predicted 704
6 SASI_Hs01_00269433 predicted 470
7 SASI_Hs01_00269434 predicted 563
8 SASI_Hs01_00269435 predicted 676
9 SASI_Hs01_00269436 predicted 693
10 SASI_Hs01_00269437 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250251 predicted 574
2 SASI_Hs01_00250252 predicted 418
3 SASI_Hs01_00250253 predicted 418
4 SASI_Hs01_00250254 predicted 571
5 SASI_Hs01_00250255 predicted 470
6 SASI_Hs01_00250256 predicted 567
7 SASI_Hs01_00250257 predicted 575
8 SASI_Hs01_00250258 predicted 462
9 SASI_Hs01_00250259 predicted 421
10 SASI_Hs01_00250260 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483362 predicted 905
2 SASI_Hs02_00483363 predicted 1415
3 SASI_Hs02_00483364 predicted 1914
4 SASI_Hs02_00483365 predicted 475
5 SASI_Hs02_00483366 predicted 638
6 SASI_Hs02_00483367 predicted 1802
7 SASI_Hs02_00483368 predicted 1899
8 SASI_Hs02_00483369 predicted 728
9 SASI_Hs02_00483370 predicted 1735
10 SASI_Hs02_00483371 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122137 predicted 2008
2 SASI_Rn02_00267605 predicted 283
3 SASI_Rn01_00122138 predicted 2017
4 SASI_Rn01_00122139 predicted 817
5 SASI_Rn01_00122140 predicted 601
6 SASI_Rn01_00122141 predicted 1931
7 SASI_Rn01_00122142 predicted 1765
8 SASI_Rn02_00267606 predicted 1732
9 SASI_Rn01_00122143 predicted 1745
10 SASI_Rn01_00122144 predicted 2010
11 SASI_Rn01_00122145 predicted 1544
12 SASI_Rn01_00122146 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183101 predicted 1728
2 SASI_Mm01_00183102 predicted 1916
3 SASI_Mm01_00183103 predicted 1718
4 SASI_Mm01_00183104 predicted 1770
5 SASI_Mm01_00183105 predicted 1930
6 SASI_Mm01_00183106 predicted 280
7 SASI_Mm01_00183107 predicted 1760
8 SASI_Mm01_00183108 predicted 952
9 SASI_Mm01_00183109 predicted 818
10 SASI_Mm01_00183110 predicted 1522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143962
CAPN8 MISSION shRNA Bacterial Glycerol Stock
calpain 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143962.1-2235s21c1
Sequence:CCGGCCACTGCTTGCTTCTTGTCACCTCGAGGTGACAAGAAGCAAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-2055s21c1
Sequence:CCGGGCAAGCTCGGCATCAACTTTGCTCGAGCAAAGTTGATGCCGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-644s21c1
Sequence:CCGGGCCAAGCTTAATGGTTGTTATCTCGAGATAACAACCATTAAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-2104s21c1
Sequence:CCGGGGAGACCCTCTTCAAACTATTCTCGAGAATAGTTTGAAGAGGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-1926s21c1
Sequence:CCGGTCTATTGGGAAACTGATTATACTCGAGTATAATCAGTTTCCCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-492s21c1
Sequence:CCGGATGCGGGAATCTTTCACTTTCCTCGAGGAAAGTGAAAGATTCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143962
CAPN8 MISSION shRNA shRNA Plasmid DNA
calpain 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143962.1-2235s21c1
Sequence:CCGGCCACTGCTTGCTTCTTGTCACCTCGAGGTGACAAGAAGCAAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-2055s21c1
Sequence:CCGGGCAAGCTCGGCATCAACTTTGCTCGAGCAAAGTTGATGCCGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-644s21c1
Sequence:CCGGGCCAAGCTTAATGGTTGTTATCTCGAGATAACAACCATTAAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-2104s21c1
Sequence:CCGGGGAGACCCTCTTCAAACTATTCTCGAGAATAGTTTGAAGAGGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-1926s21c1
Sequence:CCGGTCTATTGGGAAACTGATTATACTCGAGTATAATCAGTTTCCCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-492s21c1
Sequence:CCGGATGCGGGAATCTTTCACTTTCCTCGAGGAAAGTGAAAGATTCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143962
CAPN8 MISSION shRNA Lentiviral Transduction Particles
calpain 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143962.1-2235s21c1
Sequence:CCGGCCACTGCTTGCTTCTTGTCACCTCGAGGTGACAAGAAGCAAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-2055s21c1
Sequence:CCGGGCAAGCTCGGCATCAACTTTGCTCGAGCAAAGTTGATGCCGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-644s21c1
Sequence:CCGGGCCAAGCTTAATGGTTGTTATCTCGAGATAACAACCATTAAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-2104s21c1
Sequence:CCGGGGAGACCCTCTTCAAACTATTCTCGAGAATAGTTTGAAGAGGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-1926s21c1
Sequence:CCGGTCTATTGGGAAACTGATTATACTCGAGTATAATCAGTTTCCCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143962.1-492s21c1
Sequence:CCGGATGCGGGAATCTTTCACTTTCCTCGAGGAAAGTGAAAGATTCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130890
CAPN8 MISSION shRNA Bacterial Glycerol Stock
calpain 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130890.1-2196s1c1
Sequence:CCGGCCTGTCTCTTTGCAATCTTATCTCGAGATAAGATTGCAAAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-2062s1c1
Sequence:CCGGGCCTGGAGATCCTGTTCAAATCTCGAGATTTGAACAGGATCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-606s1c1
Sequence:CCGGGCCAAGCTCAATGGTTCGTATCTCGAGATACGAACCATTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-1727s1c1
Sequence:CCGGCCTGAATGGATTGCTTTCTAACTCGAGTTAGAAAGCAATCCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-252s1c1
Sequence:CCGGGCAGAAACTCAAGGCATCATACTCGAGTATGATGCCTTGAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130890
CAPN8 MISSION shRNA shRNA Plasmid DNA
calpain 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130890.1-2196s1c1
Sequence:CCGGCCTGTCTCTTTGCAATCTTATCTCGAGATAAGATTGCAAAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-2062s1c1
Sequence:CCGGGCCTGGAGATCCTGTTCAAATCTCGAGATTTGAACAGGATCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-606s1c1
Sequence:CCGGGCCAAGCTCAATGGTTCGTATCTCGAGATACGAACCATTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-1727s1c1
Sequence:CCGGCCTGAATGGATTGCTTTCTAACTCGAGTTAGAAAGCAATCCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-252s1c1
Sequence:CCGGGCAGAAACTCAAGGCATCATACTCGAGTATGATGCCTTGAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130890
CAPN8 MISSION shRNA Lentiviral Transduction Particles
calpain 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130890.1-2196s1c1
Sequence:CCGGCCTGTCTCTTTGCAATCTTATCTCGAGATAAGATTGCAAAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-2062s1c1
Sequence:CCGGGCCTGGAGATCCTGTTCAAATCTCGAGATTTGAACAGGATCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-606s1c1
Sequence:CCGGGCCAAGCTCAATGGTTCGTATCTCGAGATACGAACCATTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-1727s1c1
Sequence:CCGGCCTGAATGGATTGCTTTCTAACTCGAGTTAGAAAGCAATCCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130890.1-252s1c1
Sequence:CCGGGCAGAAACTCAAGGCATCATACTCGAGTATGATGCCTTGAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks