EMAIL THIS PAGE TO A FRIEND

CAPN9

calpain 9

74 Gene Product Result for
Synonyms: GC36 nCL-4
UniProtKB ID: O14815, B1APS1, B1AQI0, Q9NS74
Gene ID:
Human(10753) Summary: Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is expressed predominantly in stomach and small intestine and may have specialized functions in the digestive tract. This gene is thought to be associated with gastric cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(73647) calpain 9
Rat(116694) calpain 9
Zebrafish(445107) calpain 9
Horse(100051319) calpain 9
dog(608044) calpain 9
chicken(421544) calpain 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C1989 Anti-Calpain-9 (Domain I), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
C2239 Anti-Calpain-9 (Domain II, Catalytic Domain), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
C2364 Anti-Calpain-9 (Domain IV) (EF-1), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
C2114 Anti-Calpain-9 (Domain IV, C-Terminal), Large Subunit antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
HPA020398 Anti-CAPN9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0010753M2 Monoclonal Anti-CAPN9 antibody produced in mouse clone 3A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100328 Monoclonal Anti-CAPN9 antibody produced in mouse clone CAPN9-A278, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006615 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006615 Rosetta Predictions human pricing
NM_016452 Rosetta Predictions human pricing
XM_001054278 Rosetta Predictions rat pricing
XM_341719 Rosetta Predictions rat pricing
NM_023709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157641 predicted 477
2 SASI_Hs01_00157642 predicted 1977
3 SASI_Hs02_00341957 predicted 1335
4 SASI_Hs01_00157644 predicted 1964
5 SASI_Hs01_00157645 predicted 1772
6 SASI_Hs01_00157646 predicted 1384
7 SASI_Hs01_00157647 predicted 488
8 SASI_Hs02_00341958 predicted 1334
9 SASI_Hs01_00157648 predicted 484
10 SASI_Hs01_00157649 predicted 637
11 SASI_Hs01_00157643 predicted 1317
12 SASI_Hs01_00157650 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020361 predicted 447
2 SASI_Hs01_00020362 predicted 1868
3 SASI_Hs02_00349488 predicted 1227
4 SASI_Hs01_00020364 predicted 1859
5 SASI_Hs01_00020365 predicted 1662
6 SASI_Hs01_00020366 predicted 1273
7 SASI_Hs01_00020367 predicted 457
8 SASI_Hs02_00349489 predicted 1232
9 SASI_Hs01_00020368 predicted 452
10 SASI_Hs01_00020369 predicted 610
11 SASI_Hs01_00020363 predicted 1203
12 SASI_Hs01_00020370 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275349 predicted 1242
2 SASI_Rn02_00275350 predicted 804
3 SASI_Rn02_00275351 predicted 1502
4 SASI_Rn02_00275352 predicted 1340
5 SASI_Rn02_00275353 predicted 1792
6 SASI_Rn02_00275354 predicted 1327
7 SASI_Rn02_00275355 predicted 731
8 SASI_Rn02_00275356 predicted 942
9 SASI_Rn02_00275357 predicted 1270
10 SASI_Rn02_00275358 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393273 predicted 348
2 SASI_Rn02_00393274 predicted 1373
3 SASI_Rn02_00393275 predicted 1369
4 SASI_Rn02_00393276 predicted 603
5 SASI_Rn02_00393277 predicted 1267
6 SASI_Rn02_00393278 predicted 447
7 SASI_Rn02_00393279 predicted 1223
8 SASI_Rn02_00393280 predicted 1265
9 SASI_Rn02_00393281 predicted 1350
10 SASI_Rn02_00393282 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141354 predicted 745
2 SASI_Mm01_00141355 predicted 768
3 SASI_Mm01_00141356 predicted 1529
4 SASI_Mm01_00141357 predicted 1371
5 SASI_Mm01_00141358 predicted 1361
6 SASI_Mm01_00141360 predicted 1887
7 SASI_Mm01_00141361 predicted 1280
8 SASI_Mm01_00141362 predicted 414
9 SASI_Mm01_00141363 predicted 831
10 SASI_Mm02_00327301 predicted 1294
11 SASI_Mm01_00141359 predicted 1737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023709
CAPN9 MISSION shRNA Bacterial Glycerol Stock
calpain 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-768s1c1
Sequence:CCGGCGAACATCTCTTGGTCTCATTCTCGAGAATGAGACCAAGAGATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-1367s1c1
Sequence:CCGGCCGAAGCAAGACGTTCATCAACTCGAGTTGATGAACGTCTTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-1481s1c1
Sequence:CCGGCCTGAGAATCTTCTCTGAGAACTCGAGTTCTCAGAGAAGATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-567s1c1
Sequence:CCGGGCCAAGCTTAACGGGAGTTATCTCGAGATAACTCCCGTTAAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-2063s1c1
Sequence:CCGGCCATCTCAACATAAACGAGTTCTCGAGAACTCGTTTATGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023709
CAPN9 MISSION shRNA shRNA Plasmid DNA
calpain 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-768s1c1
Sequence:CCGGCGAACATCTCTTGGTCTCATTCTCGAGAATGAGACCAAGAGATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-1367s1c1
Sequence:CCGGCCGAAGCAAGACGTTCATCAACTCGAGTTGATGAACGTCTTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-1481s1c1
Sequence:CCGGCCTGAGAATCTTCTCTGAGAACTCGAGTTCTCAGAGAAGATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-567s1c1
Sequence:CCGGGCCAAGCTTAACGGGAGTTATCTCGAGATAACTCCCGTTAAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-2063s1c1
Sequence:CCGGCCATCTCAACATAAACGAGTTCTCGAGAACTCGTTTATGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023709
CAPN9 MISSION shRNA Lentiviral Transduction Particles
calpain 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-768s1c1
Sequence:CCGGCGAACATCTCTTGGTCTCATTCTCGAGAATGAGACCAAGAGATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-1367s1c1
Sequence:CCGGCCGAAGCAAGACGTTCATCAACTCGAGTTGATGAACGTCTTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-1481s1c1
Sequence:CCGGCCTGAGAATCTTCTCTGAGAACTCGAGTTCTCAGAGAAGATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-567s1c1
Sequence:CCGGGCCAAGCTTAACGGGAGTTATCTCGAGATAACTCCCGTTAAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023709.2-2063s1c1
Sequence:CCGGCCATCTCAACATAAACGAGTTCTCGAGAACTCGTTTATGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006615
CAPN9 MISSION shRNA Bacterial Glycerol Stock
calpain 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-750s1c1
Sequence:CCGGCCCGAGAACTTCTATGAGATTCTCGAGAATCTCATAGAAGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-1913s1c1
Sequence:CCGGCCTTCGGTTTGATGCTGACAACTCGAGTTGTCAGCATCAAACCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-876s1c1
Sequence:CCGGGCCTACAGTGTAACGGGAATTCTCGAGAATTCCCGTTACACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-645s1c1
Sequence:CCGGGCCAAGCTAAATGGGAGCTATCTCGAGATAGCTCCCATTTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-1091s1c1
Sequence:CCGGCCACTTTGATAAAGTGGAGATCTCGAGATCTCCACTTTATCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-2133s21c1
Sequence:CCGGGAGTTCATTCATCTCAATATACTCGAGTATATTGAGATGAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-847s21c1
Sequence:CCGGGGACGCCGTTTGGTCTTATTACTCGAGTAATAAGACCAAACGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-1362s21c1
Sequence:CCGGACAATCGGCTATGCCATTTATCTCGAGATAAATGGCATAGCCGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006615
CAPN9 MISSION shRNA shRNA Plasmid DNA
calpain 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-750s1c1
Sequence:CCGGCCCGAGAACTTCTATGAGATTCTCGAGAATCTCATAGAAGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-1913s1c1
Sequence:CCGGCCTTCGGTTTGATGCTGACAACTCGAGTTGTCAGCATCAAACCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-876s1c1
Sequence:CCGGGCCTACAGTGTAACGGGAATTCTCGAGAATTCCCGTTACACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-645s1c1
Sequence:CCGGGCCAAGCTAAATGGGAGCTATCTCGAGATAGCTCCCATTTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-1091s1c1
Sequence:CCGGCCACTTTGATAAAGTGGAGATCTCGAGATCTCCACTTTATCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-2133s21c1
Sequence:CCGGGAGTTCATTCATCTCAATATACTCGAGTATATTGAGATGAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-847s21c1
Sequence:CCGGGGACGCCGTTTGGTCTTATTACTCGAGTAATAAGACCAAACGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-1362s21c1
Sequence:CCGGACAATCGGCTATGCCATTTATCTCGAGATAAATGGCATAGCCGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006615
CAPN9 MISSION shRNA Lentiviral Transduction Particles
calpain 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-750s1c1
Sequence:CCGGCCCGAGAACTTCTATGAGATTCTCGAGAATCTCATAGAAGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-1913s1c1
Sequence:CCGGCCTTCGGTTTGATGCTGACAACTCGAGTTGTCAGCATCAAACCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-876s1c1
Sequence:CCGGGCCTACAGTGTAACGGGAATTCTCGAGAATTCCCGTTACACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-645s1c1
Sequence:CCGGGCCAAGCTAAATGGGAGCTATCTCGAGATAGCTCCCATTTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006615.1-1091s1c1
Sequence:CCGGCCACTTTGATAAAGTGGAGATCTCGAGATCTCCACTTTATCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-2133s21c1
Sequence:CCGGGAGTTCATTCATCTCAATATACTCGAGTATATTGAGATGAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-847s21c1
Sequence:CCGGGGACGCCGTTTGGTCTTATTACTCGAGTAATAAGACCAAACGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006615.2-1362s21c1
Sequence:CCGGACAATCGGCTATGCCATTTATCTCGAGATAAATGGCATAGCCGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks