EMAIL THIS PAGE TO A FRIEND

CAPNS2

calpain, small subunit 2

60 Gene Product Result for
UniProtKB ID: Q96L46, Q9BPV4
Gene ID:
Mouse(69543) calpain, small subunit 2
Rat(679870) calpain, small subunit 2
chicken(770982) calpain, small subunit 2
dog(487273) calpain, small subunit 2
domestic cat(101099344) calpain, small subunit 2
cow(100300424) calpain, small subunit 2
domestic guinea pig(100719638) calpain, small subunit 2
naked mole-rat(101726752) calpain, small subunit 2
sheep(101115561) calpain, small subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_894405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_894405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_894405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184601 MISSION® esiRNA esiRNA targeting mouse Capns2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032330 Rosetta Predictions human pricing
NM_001109380 Rosetta Predictions rat pricing
XM_894405 Rosetta Predictions mouse pricing
XM_912741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154530 predicted 415
2 SASI_Hs02_00359700 predicted 547
3 SASI_Hs01_00154531 predicted 487
4 SASI_Hs01_00154533 predicted 320
5 SASI_Hs01_00154534 predicted 773
6 SASI_Hs01_00154535 predicted 314
7 SASI_Hs01_00154536 predicted 375
8 SASI_Hs01_00154537 predicted 640
9 SASI_Hs01_00154538 predicted 741
10 SASI_Hs02_00359701 predicted 457
11 SASI_Hs01_00154532 predicted 501
12 SASI_Hs01_00154539 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247846 predicted 281
2 SASI_Rn02_00247847 predicted 650
3 SASI_Rn02_00247848 predicted 533
4 SASI_Rn02_00247849 predicted 517
5 SASI_Rn02_00247850 predicted 572
6 SASI_Rn02_00247851 predicted 377
7 SASI_Rn02_00247852 predicted 334
8 SASI_Rn02_00247853 predicted 586
9 SASI_Rn02_00247854 predicted 611
10 SASI_Rn02_00247855 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202885 predicted 427
2 SASI_Mm01_00202886 predicted 673
3 SASI_Mm01_00202887 predicted 705
4 SASI_Mm01_00202889 predicted 294
5 SASI_Mm01_00202890 predicted 437
6 SASI_Mm01_00202891 predicted 483
7 SASI_Mm01_00202892 predicted 367
8 SASI_Mm01_00202893 predicted 634
9 SASI_Mm01_00202894 predicted 624
10 SASI_Mm02_00429451 predicted 508
11 SASI_Mm01_00202888 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437293 predicted 667
2 SASI_Mm02_00437294 predicted 421
3 SASI_Mm02_00437295 predicted 714
4 SASI_Mm02_00437296 predicted 619
5 SASI_Mm02_00437297 predicted 364
6 SASI_Mm02_00437298 predicted 362
7 SASI_Mm02_00437299 predicted 631
8 SASI_Mm02_00437300 predicted 627
9 SASI_Mm02_00437301 predicted 507
10 SASI_Mm02_00437302 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032330
CAPNS2 MISSION shRNA Bacterial Glycerol Stock
calpain, small subunit 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-547s1c1
Sequence:CCGGGCAGTGTGTTTATAAGCAGTACTCGAGTACTGCTTATAAACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-780s1c1
Sequence:CCGGGCCTGATTCAAGTGTCTATCACTCGAGTGATAGACACTTGAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-668s1c1
Sequence:CCGGCGCCGGTATGCTAATGAAGATCTCGAGATCTTCATTAGCATACCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-242s1c1
Sequence:CCGGGCAGCTCAGTATACTCCAGAACTCGAGTTCTGGAGTATACTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032330.1-803s21c1
Sequence:CCGGGAATGGCTGCAGTTGACCATGCTCGAGCATGGTCAACTGCAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032330.1-491s21c1
Sequence:CCGGACTGGTAAGCTGGGCTTTGAACTCGAGTTCAAAGCCCAGCTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032330
CAPNS2 MISSION shRNA shRNA Plasmid DNA
calpain, small subunit 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-547s1c1
Sequence:CCGGGCAGTGTGTTTATAAGCAGTACTCGAGTACTGCTTATAAACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-780s1c1
Sequence:CCGGGCCTGATTCAAGTGTCTATCACTCGAGTGATAGACACTTGAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-668s1c1
Sequence:CCGGCGCCGGTATGCTAATGAAGATCTCGAGATCTTCATTAGCATACCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-242s1c1
Sequence:CCGGGCAGCTCAGTATACTCCAGAACTCGAGTTCTGGAGTATACTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032330.1-803s21c1
Sequence:CCGGGAATGGCTGCAGTTGACCATGCTCGAGCATGGTCAACTGCAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032330.1-491s21c1
Sequence:CCGGACTGGTAAGCTGGGCTTTGAACTCGAGTTCAAAGCCCAGCTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032330
CAPNS2 MISSION shRNA Lentiviral Transduction Particles
calpain, small subunit 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-547s1c1
Sequence:CCGGGCAGTGTGTTTATAAGCAGTACTCGAGTACTGCTTATAAACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-780s1c1
Sequence:CCGGGCCTGATTCAAGTGTCTATCACTCGAGTGATAGACACTTGAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-668s1c1
Sequence:CCGGCGCCGGTATGCTAATGAAGATCTCGAGATCTTCATTAGCATACCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032330.1-242s1c1
Sequence:CCGGGCAGCTCAGTATACTCCAGAACTCGAGTTCTGGAGTATACTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032330.1-803s21c1
Sequence:CCGGGAATGGCTGCAGTTGACCATGCTCGAGCATGGTCAACTGCAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032330.1-491s21c1
Sequence:CCGGACTGGTAAGCTGGGCTTTGAACTCGAGTTCAAAGCCCAGCTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_894405
CAPNS2 MISSION shRNA Bacterial Glycerol Stock
calpain, small subunit 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_894405.2-828s21c1
Sequence:CCGGTGGATGCAGAGAGGTAGAGACCTCGAGGTCTCTACCTCTCTGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-365s21c1
Sequence:CCGGGTGCTACTGACCTGATGAATACTCGAGTATTCATCAGGTCAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-780s21c1
Sequence:CCGGTCAGGTGTCCATCCGAGAATGCTCGAGCATTCTCGGATGGACACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-627s21c1
Sequence:CCGGCCAGCTCAATGAGCAACTTTACTCGAGTAAAGTTGCTCATTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-492s21c1
Sequence:CCGGACTGGGATTTGAGGAATTTAACTCGAGTTAAATTCCTCAAATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_894405
CAPNS2 MISSION shRNA shRNA Plasmid DNA
calpain, small subunit 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_894405.2-828s21c1
Sequence:CCGGTGGATGCAGAGAGGTAGAGACCTCGAGGTCTCTACCTCTCTGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-365s21c1
Sequence:CCGGGTGCTACTGACCTGATGAATACTCGAGTATTCATCAGGTCAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-780s21c1
Sequence:CCGGTCAGGTGTCCATCCGAGAATGCTCGAGCATTCTCGGATGGACACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-627s21c1
Sequence:CCGGCCAGCTCAATGAGCAACTTTACTCGAGTAAAGTTGCTCATTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-492s21c1
Sequence:CCGGACTGGGATTTGAGGAATTTAACTCGAGTTAAATTCCTCAAATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_894405
CAPNS2 MISSION shRNA Lentiviral Transduction Particles
calpain, small subunit 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_894405.2-828s21c1
Sequence:CCGGTGGATGCAGAGAGGTAGAGACCTCGAGGTCTCTACCTCTCTGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-365s21c1
Sequence:CCGGGTGCTACTGACCTGATGAATACTCGAGTATTCATCAGGTCAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-780s21c1
Sequence:CCGGTCAGGTGTCCATCCGAGAATGCTCGAGCATTCTCGGATGGACACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-627s21c1
Sequence:CCGGCCAGCTCAATGAGCAACTTTACTCGAGTAAAGTTGCTCATTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_894405.2-492s21c1
Sequence:CCGGACTGGGATTTGAGGAATTTAACTCGAGTTAAATTCCTCAAATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks