EMAIL THIS PAGE TO A FRIEND

CAPRIN1

cell cycle associated protein 1

350 Gene Product Result for
Synonyms: GPIAP1 GPIP137 M11S1 RNG105 p137GPI
Gene ID:
Mouse(53872) cell cycle associated protein 1
Rat(362173) cell cycle associated protein 1
chicken(426151) cell cycle associated protein 1
dog(607420) cell cycle associated protein 1
Horse(100060513) cell cycle associated protein 1
cow(535571) cell cycle associated protein 1
domestic cat(101098256) cell cycle associated protein 1
naked mole-rat(101709274) cell cycle associated protein 1
domestic guinea pig(100733092) cell cycle associated protein 1
sheep(101113623) cell cycle associated protein 1
Domestic Rabbit(100340048) cell cycle associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0073 AQUA Peptide YQEVTNNLEFA[K] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005898 Rosetta Predictions human pricing
NM_203364 Rosetta Predictions human pricing
NM_001012185 Rosetta Predictions rat pricing
XM_001052977 Rosetta Predictions rat pricing
XM_001052978 Rosetta Predictions rat pricing
XM_575185 Rosetta Predictions rat pricing
NM_001111289 Rosetta Predictions mouse pricing
NM_001111290 Rosetta Predictions mouse pricing
NM_001111291 Rosetta Predictions mouse pricing
NM_001111292 Rosetta Predictions mouse pricing
NM_016739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213233 predicted 850
2 SASI_Hs02_00340502 predicted 1809
3 SASI_Hs01_00213234 predicted 1874
4 SASI_Hs01_00213235 predicted 1048
5 SASI_Hs01_00213236 predicted 1986
6 SASI_Hs01_00213237 predicted 1274
7 SASI_Hs01_00213238 predicted 1617
8 SASI_Hs01_00213239 predicted 1335
9 SASI_Hs02_00340503 predicted 529
10 SASI_Hs01_00213241 predicted 1443
11 SASI_Hs01_00213240 predicted 1587
12 SASI_Hs01_00213242 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091155 predicted 857
2 SASI_Hs02_00373291 predicted 1811
3 SASI_Hs01_00091156 predicted 1867
4 SASI_Hs01_00091157 predicted 1047
5 SASI_Hs01_00091158 predicted 1985
6 SASI_Hs01_00091159 predicted 1273
7 SASI_Hs01_00091160 predicted 1611
8 SASI_Hs01_00091161 predicted 1337
9 SASI_Hs02_00373292 predicted 524
10 SASI_Hs01_00091163 predicted 1438
11 SASI_Hs01_00091162 predicted 1581
12 SASI_Hs01_00091164 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200390 predicted 2271
2 SASI_Rn01_00060833 predicted 928
3 SASI_Rn01_00060834 predicted 746
4 SASI_Rn01_00060835 predicted 2307
5 SASI_Rn01_00060836 predicted 2023
6 SASI_Rn01_00060837 predicted 1231
7 SASI_Rn01_00060838 predicted 1500
8 SASI_Rn01_00060839 predicted 943
9 SASI_Rn01_00060840 predicted 1009
10 SASI_Rn01_00060841 predicted 603
11 SASI_Rn01_00060832 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270898 predicted 628
2 SASI_Rn02_00270899 predicted 705
3 SASI_Rn02_00270900 predicted 928
4 SASI_Rn02_00270901 predicted 717
5 SASI_Rn02_00270902 predicted 750
6 SASI_Rn02_00270903 predicted 940
7 SASI_Rn02_00270904 predicted 758
8 SASI_Rn02_00270905 predicted 690
9 SASI_Rn02_00270906 predicted 609
10 SASI_Rn02_00270907 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270908 predicted 2275
2 SASI_Rn02_00270909 predicted 926
3 SASI_Rn02_00270910 predicted 747
4 SASI_Rn02_00270911 predicted 2305
5 SASI_Rn02_00270912 predicted 2018
6 SASI_Rn02_00270913 predicted 1222
7 SASI_Rn02_00270914 predicted 1498
8 SASI_Rn02_00270915 predicted 940
9 SASI_Rn02_00270916 predicted 1013
10 SASI_Rn02_00270917 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148935 predicted 242
2 SASI_Rn01_00148936 predicted 319
3 SASI_Rn01_00148937 predicted 542
4 SASI_Rn01_00148938 predicted 328
5 SASI_Rn01_00148939 predicted 356
6 SASI_Rn01_00148940 predicted 558
7 SASI_Rn01_00148941 predicted 369
8 SASI_Rn01_00148942 predicted 304
9 SASI_Rn01_00148943 predicted 224
10 SASI_Rn01_00148944 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306692 predicted 775
2 SASI_Mm02_00306693 predicted 759
3 SASI_Mm02_00306694 predicted 989
4 SASI_Mm02_00306695 predicted 847
5 SASI_Mm02_00306696 predicted 474
6 SASI_Mm02_00306697 predicted 427
7 SASI_Mm02_00306698 predicted 1711
8 SASI_Mm02_00306699 predicted 1790
9 SASI_Mm02_00306700 predicted 637
10 SASI_Mm02_00306701 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306702 predicted 769
2 SASI_Mm02_00306703 predicted 763
3 SASI_Mm02_00306704 predicted 993
4 SASI_Mm02_00306705 predicted 846
5 SASI_Mm02_00306706 predicted 472
6 SASI_Mm02_00306707 predicted 427
7 SASI_Mm02_00306708 predicted 1689
8 SASI_Mm02_00306709 predicted 1764
9 SASI_Mm02_00306710 predicted 639
10 SASI_Mm02_00306711 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306712 predicted 814
2 SASI_Mm02_00306713 predicted 794
3 SASI_Mm02_00306714 predicted 1030
4 SASI_Mm02_00306715 predicted 895
5 SASI_Mm02_00306716 predicted 509
6 SASI_Mm02_00306717 predicted 467
7 SASI_Mm02_00306718 predicted 1751
8 SASI_Mm02_00306719 predicted 1839
9 SASI_Mm02_00306720 predicted 675
10 SASI_Mm02_00306721 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306722 predicted 771
2 SASI_Mm02_00306723 predicted 761
3 SASI_Mm02_00306724 predicted 995
4 SASI_Mm02_00306725 predicted 850
5 SASI_Mm02_00306726 predicted 471
6 SASI_Mm02_00306727 predicted 429
7 SASI_Mm02_00306728 predicted 1713
8 SASI_Mm02_00306729 predicted 1795
9 SASI_Mm02_00306730 predicted 635
10 SASI_Mm02_00306731 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323445 predicted 808
2 SASI_Mm01_00191374 predicted 795
3 SASI_Mm01_00191375 predicted 1028
4 SASI_Mm02_00323446 predicted 889
5 SASI_Mm02_00323447 predicted 509
6 SASI_Mm01_00191379 predicted 469
7 SASI_Mm02_00323448 predicted 1755
8 SASI_Mm02_00323449 predicted 1836
9 SASI_Mm02_00323450 predicted 681
10 SASI_Mm02_00323451 predicted 1031
11 SASI_Mm01_00191373 predicted 2358
12 SASI_Mm01_00191376 predicted 2073
13 SASI_Mm01_00191377 predicted 2123
14 SASI_Mm01_00191378 predicted 1553
15 SASI_Mm01_00191380 predicted 1226
16 SASI_Mm01_00191381 predicted 631
17 SASI_Mm01_00191382 predicted 2265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016739
VALIDATED
CAPRIN1 MISSION shRNA Bacterial Glycerol Stock
cell cycle associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-1240s21c1
Sequence:CCGGGCAGCGTGTACAAGATCTTATCTCGAGATAAGATCTTGTACACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-3269s21c1
Sequence:CCGGGCCTGAAAGTTCTTAAAGAAACTCGAGTTTCTTTAAGAACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-455s21c1
Sequence:CCGGGCCGTATCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-1789s21c1
Sequence:CCGGTCAGTACCAGGCCACTTATAACTCGAGTTATAAGTGGCCTGGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016739.3-686s21c1
Sequence:CCGGTTGAGTGGAGTGCCAATATTGCTCGAGCAATATTGGCACTCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-3226s1c1
Sequence:CCGGGCCTGAAAGTTCTTAAAGAAACTCGAGTTTCTTTAAGAACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016739.2-2015s1c1
Sequence:CCGGCCAATGGATTTAGAGGAGGATCTCGAGATCCTCCTCTAAATCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016739.2-1234s1c1
Sequence:CCGGCCCTATAATTTCATACAGGATCTCGAGATCCTGTATGAAATTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-412s1c1
Sequence:CCGGGCCGTATCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-2230s1c1
Sequence:CCGGCCGCAAATGAACACTCAGCAACTCGAGTTGCTGAGTGTTCATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016739
VALIDATED
CAPRIN1 MISSION shRNA shRNA Plasmid DNA
cell cycle associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-1240s21c1
Sequence:CCGGGCAGCGTGTACAAGATCTTATCTCGAGATAAGATCTTGTACACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-3269s21c1
Sequence:CCGGGCCTGAAAGTTCTTAAAGAAACTCGAGTTTCTTTAAGAACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-455s21c1
Sequence:CCGGGCCGTATCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-1789s21c1
Sequence:CCGGTCAGTACCAGGCCACTTATAACTCGAGTTATAAGTGGCCTGGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016739.3-686s21c1
Sequence:CCGGTTGAGTGGAGTGCCAATATTGCTCGAGCAATATTGGCACTCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-3226s1c1
Sequence:CCGGGCCTGAAAGTTCTTAAAGAAACTCGAGTTTCTTTAAGAACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016739.2-2015s1c1
Sequence:CCGGCCAATGGATTTAGAGGAGGATCTCGAGATCCTCCTCTAAATCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016739.2-1234s1c1
Sequence:CCGGCCCTATAATTTCATACAGGATCTCGAGATCCTGTATGAAATTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-412s1c1
Sequence:CCGGGCCGTATCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-2230s1c1
Sequence:CCGGCCGCAAATGAACACTCAGCAACTCGAGTTGCTGAGTGTTCATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016739
VALIDATED
CAPRIN1 MISSION shRNA Lentiviral Transduction Particles
cell cycle associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-1240s21c1
Sequence:CCGGGCAGCGTGTACAAGATCTTATCTCGAGATAAGATCTTGTACACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-3269s21c1
Sequence:CCGGGCCTGAAAGTTCTTAAAGAAACTCGAGTTTCTTTAAGAACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-455s21c1
Sequence:CCGGGCCGTATCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016739.3-1789s21c1
Sequence:CCGGTCAGTACCAGGCCACTTATAACTCGAGTTATAAGTGGCCTGGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016739.3-686s21c1
Sequence:CCGGTTGAGTGGAGTGCCAATATTGCTCGAGCAATATTGGCACTCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-3226s1c1
Sequence:CCGGGCCTGAAAGTTCTTAAAGAAACTCGAGTTTCTTTAAGAACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016739.2-2015s1c1
Sequence:CCGGCCAATGGATTTAGAGGAGGATCTCGAGATCCTCCTCTAAATCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016739.2-1234s1c1
Sequence:CCGGCCCTATAATTTCATACAGGATCTCGAGATCCTGTATGAAATTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-412s1c1
Sequence:CCGGGCCGTATCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016739.2-2230s1c1
Sequence:CCGGCCGCAAATGAACACTCAGCAACTCGAGTTGCTGAGTGTTCATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005898
VALIDATED
CAPRIN1 MISSION shRNA Bacterial Glycerol Stock
cell cycle associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-472s21c1
Sequence:CCGGGCCGTTTCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-1816s21c1
Sequence:CCGGGCCAGTTATAACCAGAGCTTTCTCGAGAAAGCTCTGGTTATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-1960s21c1
Sequence:CCGGCCTCAGCAGAACACTGGATTTCTCGAGAAATCCAGTGTTCTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-2107s21c1
Sequence:CCGGCGCCCTTCATTCTCTAACACTCTCGAGAGTGTTAGAGAATGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005898.4-3513s1c1
Sequence:CCGGGCCACGTTAGTGTCACAAATTCTCGAGAATTTGTGACACTAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005898.4-472s1c1
Sequence:CCGGGCCGTTTCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-1816s1c1
Sequence:CCGGGCCAGTTATAACCAGAGCTTTCTCGAGAAAGCTCTGGTTATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-1960s1c1
Sequence:CCGGCCTCAGCAGAACACTGGATTTCTCGAGAAATCCAGTGTTCTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-2107s1c1
Sequence:CCGGCGCCCTTCATTCTCTAACACTCTCGAGAGTGTTAGAGAATGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005898
VALIDATED
CAPRIN1 MISSION shRNA shRNA Plasmid DNA
cell cycle associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-472s21c1
Sequence:CCGGGCCGTTTCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-1816s21c1
Sequence:CCGGGCCAGTTATAACCAGAGCTTTCTCGAGAAAGCTCTGGTTATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-1960s21c1
Sequence:CCGGCCTCAGCAGAACACTGGATTTCTCGAGAAATCCAGTGTTCTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-2107s21c1
Sequence:CCGGCGCCCTTCATTCTCTAACACTCTCGAGAGTGTTAGAGAATGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005898.4-3513s1c1
Sequence:CCGGGCCACGTTAGTGTCACAAATTCTCGAGAATTTGTGACACTAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005898.4-472s1c1
Sequence:CCGGGCCGTTTCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-1816s1c1
Sequence:CCGGGCCAGTTATAACCAGAGCTTTCTCGAGAAAGCTCTGGTTATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-1960s1c1
Sequence:CCGGCCTCAGCAGAACACTGGATTTCTCGAGAAATCCAGTGTTCTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-2107s1c1
Sequence:CCGGCGCCCTTCATTCTCTAACACTCTCGAGAGTGTTAGAGAATGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005898
VALIDATED
CAPRIN1 MISSION shRNA Lentiviral Transduction Particles
cell cycle associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-472s21c1
Sequence:CCGGGCCGTTTCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-1816s21c1
Sequence:CCGGGCCAGTTATAACCAGAGCTTTCTCGAGAAAGCTCTGGTTATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-1960s21c1
Sequence:CCGGCCTCAGCAGAACACTGGATTTCTCGAGAAATCCAGTGTTCTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005898.4-2107s21c1
Sequence:CCGGCGCCCTTCATTCTCTAACACTCTCGAGAGTGTTAGAGAATGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005898.4-3513s1c1
Sequence:CCGGGCCACGTTAGTGTCACAAATTCTCGAGAATTTGTGACACTAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005898.4-472s1c1
Sequence:CCGGGCCGTTTCTAAGTACCAGGAACTCGAGTTCCTGGTACTTAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-1816s1c1
Sequence:CCGGGCCAGTTATAACCAGAGCTTTCTCGAGAAAGCTCTGGTTATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-1960s1c1
Sequence:CCGGCCTCAGCAGAACACTGGATTTCTCGAGAAATCCAGTGTTCTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005898.4-2107s1c1
Sequence:CCGGCGCCCTTCATTCTCTAACACTCTCGAGAGTGTTAGAGAATGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks