EMAIL THIS PAGE TO A FRIEND

CAPRIN2

caprin family member 2

215 Gene Product Result for
Synonyms: C1QDC1 EEG-1 EEG1 RNG140
Gene ID:
Human(65981) Summary: The protein encoded by this gene may be involved in the transitioning of erythroblasts from a highly proliferative state to a terminal phase of differentiation. High level expression of the encoded protein can lead to apoptosis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(232560) caprin family member 2
Rat(686779) caprin family member 2
Zebrafish(407729) caprin family member 2
domestic cat(101087848) caprin family member 2
Horse(100069757) caprin family member 2
dog(477653) caprin family member 2
chicken(418141) caprin family member 2
cow(536187) caprin family member 2
sheep(101109694) caprin family member 2
domestic guinea pig(100714191) caprin family member 2
naked mole-rat(101725572) caprin family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039746 Anti-CAPRIN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002259 Rosetta Predictions human pricing
NM_023925 Rosetta Predictions human pricing
NM_032156 Rosetta Predictions human pricing
NM_181541 Rosetta Predictions mouse pricing
XM_132976 Rosetta Predictions mouse pricing
XM_893993 Rosetta Predictions mouse pricing
XM_901208 Rosetta Predictions mouse pricing
XM_901216 Rosetta Predictions mouse pricing
XM_901219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304148 predicted 1099
2 SASI_Hs01_00110969 predicted 2680
3 SASI_Hs01_00110970 predicted 3862
4 SASI_Hs02_00304149 predicted 2341
5 SASI_Hs01_00110971 predicted 782
6 SASI_Hs01_00110972 predicted 814
7 SASI_Hs02_00304150 predicted 1861
8 SASI_Hs02_00304151 predicted 2634
9 SASI_Hs01_00110975 predicted 3479
10 SASI_Hs01_00110976 predicted 4199
11 SASI_Hs01_00110973 predicted 1875
12 SASI_Hs01_00110974 predicted 2531
13 SASI_Hs01_00110977 predicted 3802
14 SASI_Hs01_00110978 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356380 predicted 1096
2 SASI_Hs01_00203785 predicted 2675
3 SASI_Hs01_00203786 predicted 3719
4 SASI_Hs02_00356381 predicted 2343
5 SASI_Hs01_00203787 predicted 773
6 SASI_Hs01_00203788 predicted 813
7 SASI_Hs02_00356382 predicted 1861
8 SASI_Hs02_00356383 predicted 2631
9 SASI_Hs01_00203791 predicted 3336
10 SASI_Hs01_00203792 predicted 4052
11 SASI_Hs01_00203789 predicted 1866
12 SASI_Hs01_00203790 predicted 2532
13 SASI_Hs01_00203793 predicted 3646
14 SASI_Hs01_00203794 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140597 predicted 2588
2 SASI_Hs01_00140598 predicted 3774
3 SASI_Hs01_00140599 predicted 2258
4 SASI_Hs02_00359393 predicted 1785
5 SASI_Hs02_00359394 predicted 2544
6 SASI_Hs01_00140602 predicted 3395
7 SASI_Hs02_00359395 predicted 3920
8 SASI_Hs01_00140603 predicted 3410
9 SASI_Hs01_00140604 predicted 4116
10 SASI_Hs01_00140606 predicted 1901
11 SASI_Hs01_00140600 predicted 1791
12 SASI_Hs01_00140601 predicted 2440
13 SASI_Hs01_00140605 predicted 3715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349807 predicted 979
2 SASI_Mm02_00349808 predicted 622
3 SASI_Mm02_00349809 predicted 2978
4 SASI_Mm02_00349810 predicted 546
5 SASI_Mm02_00349811 predicted 920
6 SASI_Mm02_00349812 predicted 2206
7 SASI_Mm02_00349813 predicted 2119
8 SASI_Mm02_00349814 predicted 3271
9 SASI_Mm02_00349815 predicted 1598
10 SASI_Mm02_00349816 predicted 3155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248803 predicted 1093
2 SASI_Mm01_00248804 predicted 742
3 SASI_Mm01_00248805 predicted 1875
4 SASI_Mm01_00248806 predicted 662
5 SASI_Mm01_00248807 predicted 1041
6 SASI_Mm01_00248808 predicted 2321
7 SASI_Mm01_00248809 predicted 2230
8 SASI_Mm01_00248810 predicted 3396
9 SASI_Mm01_00248811 predicted 1713
10 SASI_Mm01_00248812 predicted 3274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225775 predicted 1041
2 SASI_Mm01_00225776 predicted 678
3 SASI_Mm01_00225777 predicted 1811
4 SASI_Mm01_00225778 predicted 610
5 SASI_Mm01_00225779 predicted 976
6 SASI_Mm01_00225780 predicted 2254
7 SASI_Mm01_00225781 predicted 2173
8 SASI_Mm01_00225782 predicted 3329
9 SASI_Mm01_00225783 predicted 387
10 SASI_Mm01_00225784 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216848 predicted 851
2 SASI_Mm01_00216849 predicted 1625
3 SASI_Mm01_00216850 predicted 788
4 SASI_Mm01_00216851 predicted 2075
5 SASI_Mm01_00216852 predicted 1994
6 SASI_Mm01_00216853 predicted 3143
7 SASI_Mm01_00216854 predicted 963
8 SASI_Mm01_00216855 predicted 1468
9 SASI_Mm01_00216856 predicted 3019
10 SASI_Mm01_00216857 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251850 predicted 1183
2 SASI_Mm01_00251851 predicted 818
3 SASI_Mm01_00251852 predicted 1959
4 SASI_Mm01_00251853 predicted 748
5 SASI_Mm01_00251854 predicted 1123
6 SASI_Mm01_00251855 predicted 2400
7 SASI_Mm01_00251856 predicted 2314
8 SASI_Mm01_00251857 predicted 3470
9 SASI_Mm01_00251858 predicted 1794
10 SASI_Mm01_00251859 predicted 3353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215888 predicted 1006
2 SASI_Mm01_00215889 predicted 677
3 SASI_Mm01_00215890 predicted 1791
4 SASI_Mm01_00215891 predicted 602
5 SASI_Mm01_00215892 predicted 946
6 SASI_Mm01_00215893 predicted 2234
7 SASI_Mm01_00215894 predicted 2143
8 SASI_Mm01_00215895 predicted 3308
9 SASI_Mm01_00215896 predicted 1631
10 SASI_Mm01_00215897 predicted 3187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023925
VALIDATED
CAPRIN2 MISSION shRNA Bacterial Glycerol Stock
caprin family member 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-3335s1c1
Sequence:CCGGGCACCTTATTCCCAAAGGGATCTCGAGATCCCTTTGGGAATAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-2192s1c1
Sequence:CCGGGCAGGGTATGTTCAAGAGGAACTCGAGTTCCTCTTGAACATACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-3447s1c1
Sequence:CCGGGCCCAGAAAGAGACAACGAAACTCGAGTTTCGTTGTCTCTTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-3764s1c1
Sequence:CCGGGCAGTGAATGTGCCACTGTATCTCGAGATACAGTGGCACATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-2254s1c1
Sequence:CCGGGCAGAAAGAACAAGATCCAAACTCGAGTTTGGATCTTGTTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_023925.2-2733s1c1
Sequence:CCGGCCGTAGCATCTAAAGAACAAACTCGAGTTTGTTCTTTAGATGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_023925.2-1213s1c1
Sequence:CCGGGCATCTTAATCCAGACCAGTTCTCGAGAACTGGTCTGGATTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-3135s1c1
Sequence:CCGGCGAATGTATTTCCCAGACCTACTCGAGTAGGTCTGGGAAATACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-3196s21c1
Sequence:CCGGTACTCGTGGTGGGAGATTAATCTCGAGATTAATCTCCCACCACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_023925.3-4150s21c1
Sequence:CCGGTGAATGACAATTAGCACTAATCTCGAGATTAGTGCTAATTGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1309s21c1
Sequence:CCGGGTTGAGCCTAGATCTACTAAACTCGAGTTTAGTAGATCTAGGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1170s21c1
Sequence:CCGGAGCTCAAACTGGAGGATTATACTCGAGTATAATCCTCCAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1097s21c1
Sequence:CCGGCAAGCGTATGAGACCTATATTCTCGAGAATATAGGTCTCATACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023925
VALIDATED
CAPRIN2 MISSION shRNA shRNA Plasmid DNA
caprin family member 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-3335s1c1
Sequence:CCGGGCACCTTATTCCCAAAGGGATCTCGAGATCCCTTTGGGAATAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-2192s1c1
Sequence:CCGGGCAGGGTATGTTCAAGAGGAACTCGAGTTCCTCTTGAACATACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-3447s1c1
Sequence:CCGGGCCCAGAAAGAGACAACGAAACTCGAGTTTCGTTGTCTCTTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-3764s1c1
Sequence:CCGGGCAGTGAATGTGCCACTGTATCTCGAGATACAGTGGCACATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-2254s1c1
Sequence:CCGGGCAGAAAGAACAAGATCCAAACTCGAGTTTGGATCTTGTTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_023925.2-2733s1c1
Sequence:CCGGCCGTAGCATCTAAAGAACAAACTCGAGTTTGTTCTTTAGATGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_023925.2-1213s1c1
Sequence:CCGGGCATCTTAATCCAGACCAGTTCTCGAGAACTGGTCTGGATTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-3135s1c1
Sequence:CCGGCGAATGTATTTCCCAGACCTACTCGAGTAGGTCTGGGAAATACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-3196s21c1
Sequence:CCGGTACTCGTGGTGGGAGATTAATCTCGAGATTAATCTCCCACCACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_023925.3-4150s21c1
Sequence:CCGGTGAATGACAATTAGCACTAATCTCGAGATTAGTGCTAATTGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1309s21c1
Sequence:CCGGGTTGAGCCTAGATCTACTAAACTCGAGTTTAGTAGATCTAGGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1170s21c1
Sequence:CCGGAGCTCAAACTGGAGGATTATACTCGAGTATAATCCTCCAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1097s21c1
Sequence:CCGGCAAGCGTATGAGACCTATATTCTCGAGAATATAGGTCTCATACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023925
VALIDATED
CAPRIN2 MISSION shRNA Lentiviral Transduction Particles
caprin family member 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-3335s1c1
Sequence:CCGGGCACCTTATTCCCAAAGGGATCTCGAGATCCCTTTGGGAATAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-2192s1c1
Sequence:CCGGGCAGGGTATGTTCAAGAGGAACTCGAGTTCCTCTTGAACATACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-3447s1c1
Sequence:CCGGGCCCAGAAAGAGACAACGAAACTCGAGTTTCGTTGTCTCTTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-3764s1c1
Sequence:CCGGGCAGTGAATGTGCCACTGTATCTCGAGATACAGTGGCACATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023925.2-2254s1c1
Sequence:CCGGGCAGAAAGAACAAGATCCAAACTCGAGTTTGGATCTTGTTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_023925.2-2733s1c1
Sequence:CCGGCCGTAGCATCTAAAGAACAAACTCGAGTTTGTTCTTTAGATGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_023925.2-1213s1c1
Sequence:CCGGGCATCTTAATCCAGACCAGTTCTCGAGAACTGGTCTGGATTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023925.2-3135s1c1
Sequence:CCGGCGAATGTATTTCCCAGACCTACTCGAGTAGGTCTGGGAAATACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-3196s21c1
Sequence:CCGGTACTCGTGGTGGGAGATTAATCTCGAGATTAATCTCCCACCACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_023925.3-4150s21c1
Sequence:CCGGTGAATGACAATTAGCACTAATCTCGAGATTAGTGCTAATTGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1309s21c1
Sequence:CCGGGTTGAGCCTAGATCTACTAAACTCGAGTTTAGTAGATCTAGGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1170s21c1
Sequence:CCGGAGCTCAAACTGGAGGATTATACTCGAGTATAATCCTCCAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023925.3-1097s21c1
Sequence:CCGGCAAGCGTATGAGACCTATATTCTCGAGAATATAGGTCTCATACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181541
VALIDATED
CAPRIN2 MISSION shRNA Bacterial Glycerol Stock
caprin family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181541.3-830s21c1
Sequence:CCGGATTGCTGCACTCAGGTTATTTCTCGAGAAATAACCTGAGTGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-785s21c1
Sequence:CCGGAGTGGTAGGAACAACATATAACTCGAGTTATATGTTGTTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-2959s21c1
Sequence:CCGGTTCAGCTTGGTAGATTCAATTCTCGAGAATTGAATCTACCAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181541.3-3300s21c1
Sequence:CCGGAGCAGTCCTTGCCCTAGTGATCTCGAGATCACTAGGGCAAGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-2603s21c1
Sequence:CCGGTTACTCTCAAAGGGATAATTTCTCGAGAAATTATCCCTTTGAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181541
VALIDATED
CAPRIN2 MISSION shRNA shRNA Plasmid DNA
caprin family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181541.3-830s21c1
Sequence:CCGGATTGCTGCACTCAGGTTATTTCTCGAGAAATAACCTGAGTGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-785s21c1
Sequence:CCGGAGTGGTAGGAACAACATATAACTCGAGTTATATGTTGTTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-2959s21c1
Sequence:CCGGTTCAGCTTGGTAGATTCAATTCTCGAGAATTGAATCTACCAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181541.3-3300s21c1
Sequence:CCGGAGCAGTCCTTGCCCTAGTGATCTCGAGATCACTAGGGCAAGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-2603s21c1
Sequence:CCGGTTACTCTCAAAGGGATAATTTCTCGAGAAATTATCCCTTTGAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181541
VALIDATED
CAPRIN2 MISSION shRNA Lentiviral Transduction Particles
caprin family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181541.3-830s21c1
Sequence:CCGGATTGCTGCACTCAGGTTATTTCTCGAGAAATAACCTGAGTGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-785s21c1
Sequence:CCGGAGTGGTAGGAACAACATATAACTCGAGTTATATGTTGTTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-2959s21c1
Sequence:CCGGTTCAGCTTGGTAGATTCAATTCTCGAGAATTGAATCTACCAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181541.3-3300s21c1
Sequence:CCGGAGCAGTCCTTGCCCTAGTGATCTCGAGATCACTAGGGCAAGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181541.3-2603s21c1
Sequence:CCGGTTACTCTCAAAGGGATAATTTCTCGAGAAATTATCCCTTTGAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks