EMAIL THIS PAGE TO A FRIEND

CAPS2

calcyphosine 2

UniProtKB ID: Q9BXY5, Q6PH84, Q8N242, Q8NAY5
Gene ID:
Human(84698) Summary: Calcyphosine-2 is a calcium-binding protein with 2 EF-hand motifs (Wang et al., 2002 [PubMed 11846421]
Mouse(353025) calcyphosphine 2
Rat(366891) calcyphosine 2
chicken(417859) calcyphosine 2
cow(524599) calcyphosine 2
domestic cat(101086822) calcyphosine 2
dog(481169) calcyphosine 2
sheep(101123367) calcyphosine 2
naked mole-rat(101720529) calcyphosine 2
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066361 MISSION® esiRNA esiRNA human CAPS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032606 Rosetta Predictions human pricing
NM_001108990 Rosetta Predictions rat pricing
NM_178278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053537 predicted 1659
2 SASI_Hs01_00053539 predicted 1352
3 SASI_Hs01_00053541 predicted 1484
4 SASI_Hs02_00360155 predicted 247
5 SASI_Hs02_00360156 predicted 629
6 SASI_Hs02_00360157 predicted 747
7 SASI_Hs01_00053545 predicted 1153
8 SASI_Hs02_00360158 predicted 742
9 SASI_Hs02_00360159 predicted 516
10 SASI_Hs02_00360160 predicted 468
11 SASI_Hs01_00053538 predicted 1976
12 SASI_Hs01_00053540 predicted 2013
13 SASI_Hs01_00053542 predicted 2052
14 SASI_Hs01_00053543 predicted 1986
15 SASI_Hs01_00053544 predicted 1901
16 SASI_Hs01_00053546 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244084 predicted 773
2 SASI_Rn02_00244085 predicted 656
3 SASI_Rn02_00244086 predicted 1050
4 SASI_Rn02_00244087 predicted 819
5 SASI_Rn02_00244088 predicted 351
6 SASI_Rn02_00244089 predicted 274
7 SASI_Rn02_00244090 predicted 792
8 SASI_Rn02_00244091 predicted 628
9 SASI_Rn02_00244092 predicted 863
10 SASI_Rn02_00244093 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027793 predicted 1858
2 SASI_Mm01_00027794 predicted 488
3 SASI_Mm01_00027795 predicted 1062
4 SASI_Mm01_00027796 predicted 1609
5 SASI_Mm01_00027797 predicted 1647
6 SASI_Mm01_00027798 predicted 1738
7 SASI_Mm01_00027799 predicted 1123
8 SASI_Mm01_00027800 predicted 903
9 SASI_Mm01_00027801 predicted 441
10 SASI_Mm01_00027802 predicted 1661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032606
CAPS2 MISSION shRNA Bacterial Glycerol Stock
calcyphosine 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1967s1c1
Sequence:CCGGGCAAAGAAGCATTCTCAAGTACTCGAGTACTTGAGAATGCTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-2055s1c1
Sequence:CCGGGCAAGTCTGATGAAGTGTCATCTCGAGATGACACTTCATCAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1821s1c1
Sequence:CCGGGCAAGGTTGATTATGGAGAATCTCGAGATTCTCCATAATCAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1489s1c1
Sequence:CCGGCACATTACTTAAACTCCGAATCTCGAGATTCGGAGTTTAAGTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1550s1c1
Sequence:CCGGGCTTCTATGGAACAGGAGGATCTCGAGATCCTCCTGTTCCATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032606.3-1654s21c1
Sequence:CCGGTTGAGTCTGCATGGCTAATTCCTCGAGGAATTAGCCATGCAGACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032606.3-798s21c1
Sequence:CCGGGCAGACAACTCTTGCGATAAACTCGAGTTTATCGCAAGAGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032606
CAPS2 MISSION shRNA shRNA Plasmid DNA
calcyphosine 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1967s1c1
Sequence:CCGGGCAAAGAAGCATTCTCAAGTACTCGAGTACTTGAGAATGCTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-2055s1c1
Sequence:CCGGGCAAGTCTGATGAAGTGTCATCTCGAGATGACACTTCATCAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1821s1c1
Sequence:CCGGGCAAGGTTGATTATGGAGAATCTCGAGATTCTCCATAATCAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1489s1c1
Sequence:CCGGCACATTACTTAAACTCCGAATCTCGAGATTCGGAGTTTAAGTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1550s1c1
Sequence:CCGGGCTTCTATGGAACAGGAGGATCTCGAGATCCTCCTGTTCCATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032606.3-1654s21c1
Sequence:CCGGTTGAGTCTGCATGGCTAATTCCTCGAGGAATTAGCCATGCAGACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032606.3-798s21c1
Sequence:CCGGGCAGACAACTCTTGCGATAAACTCGAGTTTATCGCAAGAGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032606
CAPS2 MISSION shRNA Lentiviral Transduction Particles
calcyphosine 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1967s1c1
Sequence:CCGGGCAAAGAAGCATTCTCAAGTACTCGAGTACTTGAGAATGCTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-2055s1c1
Sequence:CCGGGCAAGTCTGATGAAGTGTCATCTCGAGATGACACTTCATCAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1821s1c1
Sequence:CCGGGCAAGGTTGATTATGGAGAATCTCGAGATTCTCCATAATCAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1489s1c1
Sequence:CCGGCACATTACTTAAACTCCGAATCTCGAGATTCGGAGTTTAAGTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032606.2-1550s1c1
Sequence:CCGGGCTTCTATGGAACAGGAGGATCTCGAGATCCTCCTGTTCCATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032606.3-1654s21c1
Sequence:CCGGTTGAGTCTGCATGGCTAATTCCTCGAGGAATTAGCCATGCAGACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032606.3-798s21c1
Sequence:CCGGGCAGACAACTCTTGCGATAAACTCGAGTTTATCGCAAGAGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178278
CAPS2 MISSION shRNA Bacterial Glycerol Stock
calcyphosine 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178278.2-305s1c1
Sequence:CCGGCGTGGTACAGTCCATGTTCATCTCGAGATGAACATGGACTGTACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-1910s1c1
Sequence:CCGGGCTGGCACCAAGTATCTTATACTCGAGTATAAGATACTTGGTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-2396s1c1
Sequence:CCGGGCTGAAGTAGTGCAACTTGTTCTCGAGAACAAGTTGCACTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-1914s1c1
Sequence:CCGGGCACCAAGTATCTTATAGATACTCGAGTATCTATAAGATACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178278.3-2189s21c1
Sequence:CCGGTCTTATCCTTATACCTTATACCTCGAGGTATAAGGTATAAGGATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1493s21c1
Sequence:CCGGTTGAGTCTTTCTGGCTAATTCCTCGAGGAATTAGCCAGAAAGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1810s21c1
Sequence:CCGGTACTATGAAGGCCTAAGTATACTCGAGTATACTTAGGCCTTCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1126s21c1
Sequence:CCGGGTCTATACTGGTGCAACTTTGCTCGAGCAAAGTTGCACCAGTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-493s21c1
Sequence:CCGGGACGGCTACAAGCAGTATATTCTCGAGAATATACTGCTTGTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178278
CAPS2 MISSION shRNA shRNA Plasmid DNA
calcyphosine 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178278.2-305s1c1
Sequence:CCGGCGTGGTACAGTCCATGTTCATCTCGAGATGAACATGGACTGTACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-1910s1c1
Sequence:CCGGGCTGGCACCAAGTATCTTATACTCGAGTATAAGATACTTGGTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-2396s1c1
Sequence:CCGGGCTGAAGTAGTGCAACTTGTTCTCGAGAACAAGTTGCACTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-1914s1c1
Sequence:CCGGGCACCAAGTATCTTATAGATACTCGAGTATCTATAAGATACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178278.3-2189s21c1
Sequence:CCGGTCTTATCCTTATACCTTATACCTCGAGGTATAAGGTATAAGGATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1493s21c1
Sequence:CCGGTTGAGTCTTTCTGGCTAATTCCTCGAGGAATTAGCCAGAAAGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1810s21c1
Sequence:CCGGTACTATGAAGGCCTAAGTATACTCGAGTATACTTAGGCCTTCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1126s21c1
Sequence:CCGGGTCTATACTGGTGCAACTTTGCTCGAGCAAAGTTGCACCAGTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-493s21c1
Sequence:CCGGGACGGCTACAAGCAGTATATTCTCGAGAATATACTGCTTGTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178278
CAPS2 MISSION shRNA Lentiviral Transduction Particles
calcyphosine 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178278.2-305s1c1
Sequence:CCGGCGTGGTACAGTCCATGTTCATCTCGAGATGAACATGGACTGTACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-1910s1c1
Sequence:CCGGGCTGGCACCAAGTATCTTATACTCGAGTATAAGATACTTGGTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-2396s1c1
Sequence:CCGGGCTGAAGTAGTGCAACTTGTTCTCGAGAACAAGTTGCACTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178278.2-1914s1c1
Sequence:CCGGGCACCAAGTATCTTATAGATACTCGAGTATCTATAAGATACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178278.3-2189s21c1
Sequence:CCGGTCTTATCCTTATACCTTATACCTCGAGGTATAAGGTATAAGGATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1493s21c1
Sequence:CCGGTTGAGTCTTTCTGGCTAATTCCTCGAGGAATTAGCCAGAAAGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1810s21c1
Sequence:CCGGTACTATGAAGGCCTAAGTATACTCGAGTATACTTAGGCCTTCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-1126s21c1
Sequence:CCGGGTCTATACTGGTGCAACTTTGCTCGAGCAAAGTTGCACCAGTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178278.3-493s21c1
Sequence:CCGGGACGGCTACAAGCAGTATATTCTCGAGAATATACTGCTTGTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks