EMAIL THIS PAGE TO A FRIEND

CAPS

calcyphosine

36 Gene Product Result for
Synonyms: CAPS1
UniProtKB ID: Q13938, Q3MJA7, Q8WUZ3
Gene ID:
Human(828) Summary: This gene encodes a calcium-binding protein, which may play a role in the regulation of ion transport. A similar protein was first described as a potentially important regulatory protein in the dog thyroid and was termed as R2D5 antigen in rabbit. Alternative splicing of this gene generates two transcript variants. [provided by RefSeq, Jul 2008]
sheep(101107783) calcyphosine
fruit fly(39493) capricious
fruit fly(49968) Calcium activated protein for secretion
cow(616482) calcyphosine
dog(403965) calcyphosine
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004058 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035181 MISSION® esiRNA esiRNA human CAPS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004058 Rosetta Predictions human pricing
NM_080590 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038059 predicted 241
2 SASI_Hs01_00038060 predicted 934
3 SASI_Hs01_00038061 predicted 870
4 SASI_Hs01_00038065 predicted 218
5 SASI_Hs01_00038066 predicted 863
6 SASI_Hs01_00038067 predicted 235
7 SASI_Hs01_00038068 predicted 934
8 SASI_Hs02_00336832 predicted 862
9 SASI_Hs02_00336833 predicted 874
10 SASI_Hs01_00038064 predicted 873
11 SASI_Hs01_00038062 predicted 240
12 SASI_Hs01_00038063 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228114 predicted 235
2 SASI_Hs01_00228115 predicted 849
3 SASI_Hs01_00228116 predicted 786
4 SASI_Hs01_00228120 predicted 221
5 SASI_Hs01_00228121 predicted 781
6 SASI_Hs01_00228122 predicted 237
7 SASI_Hs01_00228123 predicted 846
8 SASI_Hs02_00362318 predicted 777
9 SASI_Hs02_00362319 predicted 797
10 SASI_Hs01_00228119 predicted 786
11 SASI_Hs01_00228117 predicted 235
12 SASI_Hs01_00228118 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004058
CAPS MISSION shRNA Bacterial Glycerol Stock
calcyphosine
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004058.3-660s21c1
Sequence:CCGGTGCCTCCATGAACACGGATGACTCGAGTCATCCGTGTTCATGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-1168s21c1
Sequence:CCGGCCTAACCTCAGAAACTGAAATCTCGAGATTTCAGTTTCTGAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-896s21c1
Sequence:CCGGAGGTGGGACAAAGGTCCTAACCTCGAGGTTAGGACCTTTGTCCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-966s21c1
Sequence:CCGGCCATGCTGACCAGAGATCTTGCTCGAGCAAGATCTCTGGTCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-562s1c1
Sequence:CCGGCAACTTCGACTCCTCTGAGAACTCGAGTTCTCAGAGGAGTCGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-216s1c1
Sequence:CCGGGCCAACTAGACCGGGACGGGACTCGAGTCCCGTCCCGGTCTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-320s1c1
Sequence:CCGGTGCAGGAAGTGGGACCGCAATCTCGAGATTGCGGTCCCACTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-353s1c1
Sequence:CCGGCTGGATCTGGAGGAGTTCCTTCTCGAGAAGGAACTCCTCCAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-589s1c1
Sequence:CCGGGCAGGTCACACTGGCGGAATTCTCGAGAATTCCGCCAGTGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004058
CAPS MISSION shRNA shRNA Plasmid DNA
calcyphosine
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004058.3-660s21c1
Sequence:CCGGTGCCTCCATGAACACGGATGACTCGAGTCATCCGTGTTCATGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-1168s21c1
Sequence:CCGGCCTAACCTCAGAAACTGAAATCTCGAGATTTCAGTTTCTGAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-896s21c1
Sequence:CCGGAGGTGGGACAAAGGTCCTAACCTCGAGGTTAGGACCTTTGTCCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-966s21c1
Sequence:CCGGCCATGCTGACCAGAGATCTTGCTCGAGCAAGATCTCTGGTCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-562s1c1
Sequence:CCGGCAACTTCGACTCCTCTGAGAACTCGAGTTCTCAGAGGAGTCGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-216s1c1
Sequence:CCGGGCCAACTAGACCGGGACGGGACTCGAGTCCCGTCCCGGTCTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-320s1c1
Sequence:CCGGTGCAGGAAGTGGGACCGCAATCTCGAGATTGCGGTCCCACTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-353s1c1
Sequence:CCGGCTGGATCTGGAGGAGTTCCTTCTCGAGAAGGAACTCCTCCAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-589s1c1
Sequence:CCGGGCAGGTCACACTGGCGGAATTCTCGAGAATTCCGCCAGTGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004058
CAPS MISSION shRNA Lentiviral Transduction Particles
calcyphosine
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004058.3-660s21c1
Sequence:CCGGTGCCTCCATGAACACGGATGACTCGAGTCATCCGTGTTCATGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-1168s21c1
Sequence:CCGGCCTAACCTCAGAAACTGAAATCTCGAGATTTCAGTTTCTGAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-896s21c1
Sequence:CCGGAGGTGGGACAAAGGTCCTAACCTCGAGGTTAGGACCTTTGTCCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004058.3-966s21c1
Sequence:CCGGCCATGCTGACCAGAGATCTTGCTCGAGCAAGATCTCTGGTCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-562s1c1
Sequence:CCGGCAACTTCGACTCCTCTGAGAACTCGAGTTCTCAGAGGAGTCGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-216s1c1
Sequence:CCGGGCCAACTAGACCGGGACGGGACTCGAGTCCCGTCCCGGTCTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-320s1c1
Sequence:CCGGTGCAGGAAGTGGGACCGCAATCTCGAGATTGCGGTCCCACTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-353s1c1
Sequence:CCGGCTGGATCTGGAGGAGTTCCTTCTCGAGAAGGAACTCCTCCAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004058.2-589s1c1
Sequence:CCGGGCAGGTCACACTGGCGGAATTCTCGAGAATTCCGCCAGTGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks