EMAIL THIS PAGE TO A FRIEND

CAPSL

calcyphosine-like

65 Gene Product Result for
UniProtKB ID: Q8WWF8
Gene ID:
Mouse(75568) calcyphosine-like
Rat(294795) calcyphosine-like
naked mole-rat(101708418) calcyphosine-like
domestic guinea pig(100721524) calcyphosine-like
sheep(101110872) calcyphosine-like
chicken(426055) calcyphosine-like
cow(507306) calcyphosine-like
Horse(100053745) calcyphosine-like
domestic cat(101100184) calcyphosine-like
dog(100688904) calcyphosine-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052451 MISSION® esiRNA esiRNA human CAPSL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042625 Rosetta Predictions human pricing
NM_144647 Rosetta Predictions human pricing
NM_001106417 Rosetta Predictions rat pricing
NM_029341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310823 predicted 498
2 SASI_Hs02_00310824 predicted 491
3 SASI_Hs02_00310825 predicted 383
4 SASI_Hs02_00310826 predicted 429
5 SASI_Hs02_00310827 predicted 465
6 SASI_Hs02_00310828 predicted 666
7 SASI_Hs02_00310829 predicted 485
8 SASI_Hs02_00310830 predicted 365
9 SASI_Hs02_00310831 predicted 663
10 SASI_Hs02_00310832 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364508 predicted 535
2 SASI_Hs01_00051810 predicted 521
3 SASI_Hs01_00051812 predicted 413
4 SASI_Hs01_00051815 predicted 466
5 SASI_Hs02_00364509 predicted 495
6 SASI_Hs01_00051816 predicted 691
7 SASI_Hs02_00364510 predicted 517
8 SASI_Hs02_00364511 predicted 398
9 SASI_Hs02_00364512 predicted 697
10 SASI_Hs02_00364513 predicted 631
11 SASI_Hs01_00051808 predicted 283
12 SASI_Hs01_00051809 predicted 261
13 SASI_Hs01_00051811 predicted 279
14 SASI_Hs01_00051813 predicted 269
15 SASI_Hs01_00051814 predicted 407
16 SASI_Hs01_00051817 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218758 predicted 565
2 SASI_Rn02_00218759 predicted 203
3 SASI_Rn02_00218760 predicted 279
4 SASI_Rn02_00218761 predicted 318
5 SASI_Rn02_00218762 predicted 530
6 SASI_Rn02_00218763 predicted 411
7 SASI_Rn02_00218764 predicted 249
8 SASI_Rn02_00218765 predicted 542
9 SASI_Rn02_00218766 predicted 597
10 SASI_Rn02_00218767 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335175 predicted 202
2 SASI_Mm01_00192256 predicted 543
3 SASI_Mm01_00192257 predicted 569
4 SASI_Mm01_00192259 predicted 684
5 SASI_Mm01_00192260 predicted 597
6 SASI_Mm01_00192261 predicted 634
7 SASI_Mm01_00192262 predicted 706
8 SASI_Mm01_00192264 predicted 542
9 SASI_Mm02_00335176 predicted 281
10 SASI_Mm02_00335177 predicted 266
11 SASI_Mm01_00192258 predicted 440
12 SASI_Mm01_00192263 predicted 602
13 SASI_Mm01_00192265 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144647
CAPSL MISSION shRNA Bacterial Glycerol Stock
calcyphosine-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144647.3-735s21c1
Sequence:CCGGGAACCGCCTGGAAGCTTTAAGCTCGAGCTTAAAGCTTCCAGGCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144647.3-791s21c1
Sequence:CCGGGTGGCTCCAAATGACTAAATGCTCGAGCATTTAGTCATTTGGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144647.3-837s21c1
Sequence:CCGGTGATTTCACACTCATCCTAATCTCGAGATTAGGATGAGTGTGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144647.3-502s21c1
Sequence:CCGGGACTGGAGATGGTGTTATAACCTCGAGGTTATAACACCATCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-619s1c1
Sequence:CCGGGATAACTTTGATTCACCCTATCTCGAGATAGGGTGAATCAAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-286s1c1
Sequence:CCGGGACGATAATAATCGAACCCTTCTCGAGAAGGGTTCGATTATTATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-382s1c1
Sequence:CCGGCGGAGGTTTGATAAAGATGGACTCGAGTCCATCTTTATCAAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-592s1c1
Sequence:CCGGGAGGAACAAGTATTTAGGAAACTCGAGTTTCCTAAATACTTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-528s1c1
Sequence:CCGGCGAAGACCTTCGTGAAGTATACTCGAGTATACTTCACGAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144647
CAPSL MISSION shRNA shRNA Plasmid DNA
calcyphosine-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144647.3-735s21c1
Sequence:CCGGGAACCGCCTGGAAGCTTTAAGCTCGAGCTTAAAGCTTCCAGGCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144647.3-791s21c1
Sequence:CCGGGTGGCTCCAAATGACTAAATGCTCGAGCATTTAGTCATTTGGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144647.3-837s21c1
Sequence:CCGGTGATTTCACACTCATCCTAATCTCGAGATTAGGATGAGTGTGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144647.3-502s21c1
Sequence:CCGGGACTGGAGATGGTGTTATAACCTCGAGGTTATAACACCATCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-619s1c1
Sequence:CCGGGATAACTTTGATTCACCCTATCTCGAGATAGGGTGAATCAAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-286s1c1
Sequence:CCGGGACGATAATAATCGAACCCTTCTCGAGAAGGGTTCGATTATTATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-382s1c1
Sequence:CCGGCGGAGGTTTGATAAAGATGGACTCGAGTCCATCTTTATCAAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-592s1c1
Sequence:CCGGGAGGAACAAGTATTTAGGAAACTCGAGTTTCCTAAATACTTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-528s1c1
Sequence:CCGGCGAAGACCTTCGTGAAGTATACTCGAGTATACTTCACGAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144647
CAPSL MISSION shRNA Lentiviral Transduction Particles
calcyphosine-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144647.3-735s21c1
Sequence:CCGGGAACCGCCTGGAAGCTTTAAGCTCGAGCTTAAAGCTTCCAGGCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144647.3-791s21c1
Sequence:CCGGGTGGCTCCAAATGACTAAATGCTCGAGCATTTAGTCATTTGGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144647.3-837s21c1
Sequence:CCGGTGATTTCACACTCATCCTAATCTCGAGATTAGGATGAGTGTGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144647.3-502s21c1
Sequence:CCGGGACTGGAGATGGTGTTATAACCTCGAGGTTATAACACCATCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-619s1c1
Sequence:CCGGGATAACTTTGATTCACCCTATCTCGAGATAGGGTGAATCAAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-286s1c1
Sequence:CCGGGACGATAATAATCGAACCCTTCTCGAGAAGGGTTCGATTATTATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-382s1c1
Sequence:CCGGCGGAGGTTTGATAAAGATGGACTCGAGTCCATCTTTATCAAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-592s1c1
Sequence:CCGGGAGGAACAAGTATTTAGGAAACTCGAGTTTCCTAAATACTTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144647.2-528s1c1
Sequence:CCGGCGAAGACCTTCGTGAAGTATACTCGAGTATACTTCACGAAGGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029341
CAPSL MISSION shRNA Bacterial Glycerol Stock
calcyphosine-like
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-539s21c1
Sequence:CCGGTGAAGACCTTCGTGAAGTTTACTCGAGTAAACTTCACGAAGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-405s21c1
Sequence:CCGGAGAGACGGCAGTGGAACAATACTCGAGTATTGTTCCACTGCCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-433s21c1
Sequence:CCGGATGAGTTTCTTCTCACGTTAACTCGAGTTAACGTGAGAAGAAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-723s1c1
Sequence:CCGGGATGTGTACTTCATCATCATGCTCGAGCATGATGATGAAGTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-421s1c1
Sequence:CCGGCAATAGACTTCAATGAGTTTCCTCGAGGAAACTCATTGAAGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-540s1c1
Sequence:CCGGGAAGACCTTCGTGAAGTTTATCTCGAGATAAACTTCACGAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-696s1c1
Sequence:CCGGGCAGGTGTAAGTGCATCCATTCTCGAGAATGGATGCACTTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-564s1c1
Sequence:CCGGGCTAAACATCATCCAAAGTATCTCGAGATACTTTGGATGATGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-603s1c1
Sequence:CCGGGAGGAACAAGTCTTCAGGAAACTCGAGTTTCCTGAAGACTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-630s1c1
Sequence:CCGGGATAACTTTGACTCACCCTATCTCGAGATAGGGTGAGTCAAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-614s1c1
Sequence:CCGGCTTCAGGAAATTTCTGGATAACTCGAGTTATCCAGAAATTTCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029341
CAPSL MISSION shRNA shRNA Plasmid DNA
calcyphosine-like
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-539s21c1
Sequence:CCGGTGAAGACCTTCGTGAAGTTTACTCGAGTAAACTTCACGAAGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-405s21c1
Sequence:CCGGAGAGACGGCAGTGGAACAATACTCGAGTATTGTTCCACTGCCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-433s21c1
Sequence:CCGGATGAGTTTCTTCTCACGTTAACTCGAGTTAACGTGAGAAGAAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-723s1c1
Sequence:CCGGGATGTGTACTTCATCATCATGCTCGAGCATGATGATGAAGTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-421s1c1
Sequence:CCGGCAATAGACTTCAATGAGTTTCCTCGAGGAAACTCATTGAAGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-540s1c1
Sequence:CCGGGAAGACCTTCGTGAAGTTTATCTCGAGATAAACTTCACGAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-696s1c1
Sequence:CCGGGCAGGTGTAAGTGCATCCATTCTCGAGAATGGATGCACTTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-564s1c1
Sequence:CCGGGCTAAACATCATCCAAAGTATCTCGAGATACTTTGGATGATGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-603s1c1
Sequence:CCGGGAGGAACAAGTCTTCAGGAAACTCGAGTTTCCTGAAGACTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-630s1c1
Sequence:CCGGGATAACTTTGACTCACCCTATCTCGAGATAGGGTGAGTCAAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-614s1c1
Sequence:CCGGCTTCAGGAAATTTCTGGATAACTCGAGTTATCCAGAAATTTCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029341
CAPSL MISSION shRNA Lentiviral Transduction Particles
calcyphosine-like
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-539s21c1
Sequence:CCGGTGAAGACCTTCGTGAAGTTTACTCGAGTAAACTTCACGAAGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-405s21c1
Sequence:CCGGAGAGACGGCAGTGGAACAATACTCGAGTATTGTTCCACTGCCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029341.1-433s21c1
Sequence:CCGGATGAGTTTCTTCTCACGTTAACTCGAGTTAACGTGAGAAGAAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-723s1c1
Sequence:CCGGGATGTGTACTTCATCATCATGCTCGAGCATGATGATGAAGTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-421s1c1
Sequence:CCGGCAATAGACTTCAATGAGTTTCCTCGAGGAAACTCATTGAAGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-540s1c1
Sequence:CCGGGAAGACCTTCGTGAAGTTTATCTCGAGATAAACTTCACGAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029341.1-696s1c1
Sequence:CCGGGCAGGTGTAAGTGCATCCATTCTCGAGAATGGATGCACTTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-564s1c1
Sequence:CCGGGCTAAACATCATCCAAAGTATCTCGAGATACTTTGGATGATGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-603s1c1
Sequence:CCGGGAGGAACAAGTCTTCAGGAAACTCGAGTTTCCTGAAGACTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-630s1c1
Sequence:CCGGGATAACTTTGACTCACCCTATCTCGAGATAGGGTGAGTCAAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029341.1-614s1c1
Sequence:CCGGCTTCAGGAAATTTCTGGATAACTCGAGTTATCCAGAAATTTCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks