EMAIL THIS PAGE TO A FRIEND

CAPZA1

capping protein (actin filament) muscle Z-line, alpha 1

174 Gene Product Result for
Synonyms: CAPPA1 CAPZ CAZ1
UniProtKB ID: P52907, Q53FQ6, Q6FHD5
Gene ID:
Human(829) Summary: CAPZA1 is a member of the F-actin capping protein alpha subunit family. This gene encodes the alpha subunit of the barbed-end actin binding protein. The protein regulates growth of the actin filament by capping the barbed end of growing actin filaments. [provided by RefSeq, Jul 2008]
Mouse(12340) capping protein (actin filament) muscle Z-line, alpha 1
Rat(691149) capping protein (actin filament) muscle Z-line, alpha 1
chicken(396521) capping protein (actin filament) muscle Z-line, alpha 1
cow(534656) capping protein (actin filament) muscle Z-line, alpha 1
domestic cat(101098072) capping protein (actin filament) muscle Z-line, alpha 1
dog(475857) capping protein (actin filament) muscle Z-line, alpha 1
naked mole-rat(101702218) capping protein (actin filament) muscle Z-line, alpha 1
domestic guinea pig(100726521) capping protein (actin filament) muscle Z-line, alpha 1
sheep(101117461) capping protein (actin filament) muscle Z-line, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107831 MISSION® esiRNA esiRNA human CAPZA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006135 Rosetta Predictions human pricing
NM_001109625 Rosetta Predictions rat pricing
NM_009797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103804 predicted 1030
2 SASI_Hs01_00103806 predicted 845
3 SASI_Hs01_00103807 predicted 1006
4 SASI_Hs01_00103809 predicted 596
5 SASI_Hs01_00103810 predicted 1253
6 SASI_Hs01_00103811 predicted 982
7 SASI_Hs01_00103812 predicted 1238
8 SASI_Hs02_00340964 predicted 681
9 SASI_Hs01_00103813 predicted 848
10 SASI_Hs02_00340965 predicted 809
11 SASI_Hs01_00103805 predicted 1058
12 SASI_Hs01_00103808 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250202 predicted 667
2 SASI_Rn02_00250203 predicted 699
3 SASI_Rn02_00250204 predicted 948
4 SASI_Rn02_00250205 predicted 670
5 SASI_Rn02_00250206 predicted 360
6 SASI_Rn02_00250207 predicted 901
7 SASI_Rn02_00250208 predicted 1198
8 SASI_Rn02_00250209 predicted 861
9 SASI_Rn02_00250210 predicted 471
10 SASI_Rn02_00250211 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317064 predicted 407
2 SASI_Mm02_00317065 predicted 413
3 SASI_Mm01_00029390 predicted 792
4 SASI_Mm02_00317066 predicted 309
5 SASI_Mm01_00029396 predicted 534
6 SASI_Mm02_00317067 predicted 775
7 SASI_Mm01_00029394 predicted 991
8 SASI_Mm01_00029399 predicted 741
9 SASI_Mm02_00317068 predicted 769
10 SASI_Mm02_00317069 predicted 629
11 SASI_Mm01_00029391 predicted 303
12 SASI_Mm01_00029392 predicted 677
13 SASI_Mm01_00029393 predicted 296
14 SASI_Mm01_00029395 predicted 304
15 SASI_Mm01_00029397 predicted 402
16 SASI_Mm01_00029398 predicted 661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006135
VALIDATED
CAPZA1 MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, alpha 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006135.1-1981s1c1
Sequence:CCGGCCAGGTATATTCGGCAGGTATCTCGAGATACCTGCCGAATATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-49s1c1
Sequence:CCGGGCTGCTAAATTCATCACTCATCTCGAGATGAGTGATGAATTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-445s1c1
Sequence:CCGGGATGGGCAACAGACTATTATTCTCGAGAATAATAGTCTGTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006135.1-165s1c1
Sequence:CCGGCCAGTATAACATGGATCAGTTCTCGAGAACTGATCCATGTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-389s1c1
Sequence:CCGGCCTATGTGAAAGACCATTATTCTCGAGAATAATGGTCTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-781s21c1
Sequence:CCGGCCTATGTGAAAGACCATTATTCTCGAGAATAATGGTCTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-494s21c1
Sequence:CCGGTGACGTTCGGCTACTACTTAACTCGAGTTAAGTAGTAGCCGAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-837s21c1
Sequence:CCGGGATGGGCAACAGACTATTATTCTCGAGAATAATAGTCTGTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-441s21c1
Sequence:CCGGGCTGCTAAATTCATCACTCATCTCGAGATGAGTGATGAATTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-1598s21c1
Sequence:CCGGCTGATTTAGACAAGGTATTATCTCGAGATAATACCTTGTCTAAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006135
VALIDATED
CAPZA1 MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, alpha 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006135.1-1981s1c1
Sequence:CCGGCCAGGTATATTCGGCAGGTATCTCGAGATACCTGCCGAATATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-49s1c1
Sequence:CCGGGCTGCTAAATTCATCACTCATCTCGAGATGAGTGATGAATTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-445s1c1
Sequence:CCGGGATGGGCAACAGACTATTATTCTCGAGAATAATAGTCTGTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006135.1-165s1c1
Sequence:CCGGCCAGTATAACATGGATCAGTTCTCGAGAACTGATCCATGTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-389s1c1
Sequence:CCGGCCTATGTGAAAGACCATTATTCTCGAGAATAATGGTCTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-781s21c1
Sequence:CCGGCCTATGTGAAAGACCATTATTCTCGAGAATAATGGTCTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-494s21c1
Sequence:CCGGTGACGTTCGGCTACTACTTAACTCGAGTTAAGTAGTAGCCGAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-837s21c1
Sequence:CCGGGATGGGCAACAGACTATTATTCTCGAGAATAATAGTCTGTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-441s21c1
Sequence:CCGGGCTGCTAAATTCATCACTCATCTCGAGATGAGTGATGAATTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-1598s21c1
Sequence:CCGGCTGATTTAGACAAGGTATTATCTCGAGATAATACCTTGTCTAAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006135
VALIDATED
CAPZA1 MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, alpha 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006135.1-1981s1c1
Sequence:CCGGCCAGGTATATTCGGCAGGTATCTCGAGATACCTGCCGAATATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-49s1c1
Sequence:CCGGGCTGCTAAATTCATCACTCATCTCGAGATGAGTGATGAATTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-445s1c1
Sequence:CCGGGATGGGCAACAGACTATTATTCTCGAGAATAATAGTCTGTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006135.1-165s1c1
Sequence:CCGGCCAGTATAACATGGATCAGTTCTCGAGAACTGATCCATGTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006135.1-389s1c1
Sequence:CCGGCCTATGTGAAAGACCATTATTCTCGAGAATAATGGTCTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-781s21c1
Sequence:CCGGCCTATGTGAAAGACCATTATTCTCGAGAATAATGGTCTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-494s21c1
Sequence:CCGGTGACGTTCGGCTACTACTTAACTCGAGTTAAGTAGTAGCCGAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-837s21c1
Sequence:CCGGGATGGGCAACAGACTATTATTCTCGAGAATAATAGTCTGTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-441s21c1
Sequence:CCGGGCTGCTAAATTCATCACTCATCTCGAGATGAGTGATGAATTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006135.2-1598s21c1
Sequence:CCGGCTGATTTAGACAAGGTATTATCTCGAGATAATACCTTGTCTAAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009797
CAPZA1 MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009797.1-2007s1c1
Sequence:CCGGCCAGAGTTCTACTATGTTTAACTCGAGTTAAACATAGTAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-65s1c1
Sequence:CCGGGCCGCTAAATTCATCACCCATCTCGAGATGGGTGATGAATTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-404s1c1
Sequence:CCGGGCCTATGTGAAAGATCATTATCTCGAGATAATGATCTTTCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-284s1c1
Sequence:CCGGCCAAGAAACCAAATTTCCTTTCTCGAGAAAGGAAATTTGGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-128s1c1
Sequence:CCGGCTACTGCTTAACAATGACAATCTCGAGATTGTCATTGTTAAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009797
CAPZA1 MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009797.1-2007s1c1
Sequence:CCGGCCAGAGTTCTACTATGTTTAACTCGAGTTAAACATAGTAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-65s1c1
Sequence:CCGGGCCGCTAAATTCATCACCCATCTCGAGATGGGTGATGAATTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-404s1c1
Sequence:CCGGGCCTATGTGAAAGATCATTATCTCGAGATAATGATCTTTCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-284s1c1
Sequence:CCGGCCAAGAAACCAAATTTCCTTTCTCGAGAAAGGAAATTTGGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-128s1c1
Sequence:CCGGCTACTGCTTAACAATGACAATCTCGAGATTGTCATTGTTAAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009797
CAPZA1 MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009797.1-2007s1c1
Sequence:CCGGCCAGAGTTCTACTATGTTTAACTCGAGTTAAACATAGTAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-65s1c1
Sequence:CCGGGCCGCTAAATTCATCACCCATCTCGAGATGGGTGATGAATTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-404s1c1
Sequence:CCGGGCCTATGTGAAAGATCATTATCTCGAGATAATGATCTTTCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-284s1c1
Sequence:CCGGCCAAGAAACCAAATTTCCTTTCTCGAGAAAGGAAATTTGGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009797.1-128s1c1
Sequence:CCGGCTACTGCTTAACAATGACAATCTCGAGATTGTCATTGTTAAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks