EMAIL THIS PAGE TO A FRIEND

CAPZA2

capping protein (actin filament) muscle Z-line, alpha 2

166 Gene Product Result for
Synonyms: CAPPA2 CAPZ
UniProtKB ID: P47755
Gene ID:
Human(830) Summary: The protein encoded by this gene is a member of the F-actin capping protein alpha subunit family. It is the alpha subunit of the barbed-end actin binding protein Cap Z. By capping the barbed end of actin filaments, Cap Z regulates the growth of the actin filaments at the barbed end. [provided by RefSeq, Jul 2008]
Mouse(12343) capping protein (actin filament) muscle Z-line, alpha 2
Rat(493810) capping protein (actin filament) muscle Z-line, alpha 2
chicken(417771) capping protein (actin filament) muscle Z-line, alpha 2
dog(503863) capping protein (actin filament) muscle Z-line, alpha 2
Horse(100071181) capping protein (actin filament) muscle Z-line, alpha 2
cow(493728) capping protein (actin filament) muscle Z-line, alpha 2
domestic cat(493670) capping protein (actin filament) muscle Z-line, alpha 2
naked mole-rat(101725379) capping protein (actin filament) muscle Z-line, alpha 2
domestic guinea pig(100135645) capping protein (actin filament) muscle Z-line, alpha 2
domestic guinea pig(100732132) capping protein (actin filament) muscle Z-line, alpha 2
sheep(101109168) capping protein (actin filament) muscle Z-line, alpha 2
sheep(100126578) capping protein (actin filament) muscle Z-line, alpha 2
Domestic Rabbit(100126568) capping protein (actin filament) muscle Z-line, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006136 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006136 Rosetta Predictions human pricing
NM_001009180 Rosetta Predictions rat pricing
NM_007604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024777 predicted 555
2 SASI_Hs01_00024778 predicted 622
3 SASI_Hs01_00024779 predicted 965
4 SASI_Hs02_00340966 predicted 307
5 SASI_Hs01_00024780 predicted 886
6 SASI_Hs01_00024782 predicted 748
7 SASI_Hs01_00024783 predicted 854
8 SASI_Hs01_00024784 predicted 734
9 SASI_Hs01_00024785 predicted 905
10 SASI_Hs02_00340967 predicted 370
11 SASI_Hs01_00024781 predicted 721
12 SASI_Hs01_00024786 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102519 predicted 904
2 SASI_Rn01_00102520 predicted 671
3 SASI_Rn02_00199498 predicted 327
4 SASI_Rn01_00102522 predicted 807
5 SASI_Rn01_00102523 predicted 677
6 SASI_Rn01_00102524 predicted 336
7 SASI_Rn01_00102525 predicted 212
8 SASI_Rn01_00102526 predicted 266
9 SASI_Rn01_00102527 predicted 258
10 SASI_Rn01_00102528 predicted 783
11 SASI_Rn01_00102521 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312047 predicted 863
2 SASI_Mm02_00312048 predicted 290
3 SASI_Mm01_00192152 predicted 525
4 SASI_Mm01_00192153 predicted 640
5 SASI_Mm01_00192154 predicted 491
6 SASI_Mm01_00192155 predicted 475
7 SASI_Mm01_00192158 predicted 751
8 SASI_Mm01_00192159 predicted 816
9 SASI_Mm01_00192160 predicted 297
10 SASI_Mm01_00192161 predicted 671
11 SASI_Mm01_00192156 predicted 819
12 SASI_Mm01_00192157 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007604
VALIDATED
CAPZA2 MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, alpha 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-745s21c1
Sequence:CCGGACTGCCATCAGTGAGAATTATCTCGAGATAATTCTCACTGATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-1020s21c1
Sequence:CCGGAGCACAGAGCTTAGCTAATAACTCGAGTTATTAGCTAAGCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007604.2-51s21c1
Sequence:CCGGCGATGAGGAGAAGGTTCGTATCTCGAGATACGAACCTTCTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-127s21c1
Sequence:CCGGGATGTTCGATTATTGCTTAATCTCGAGATTAAGCAATAATCGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-664s21c1
Sequence:CCGGGATTCCCTCACAGTATCTAATCTCGAGATTAGATACTGTGAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-1310s21c1
Sequence:CCGGAGTAATGGGCACTCTAGTTAACTCGAGTTAACTAGAGTGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007604.2-397s21c1
Sequence:CCGGGAAACTGCACTGCGAGCTTATCTCGAGATAAGCTCGCAGTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007604.2-1805s1c1
Sequence:CCGGCCAGTGAATCATACACTATTTCTCGAGAAATAGTGTATGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-51s1c1
Sequence:CCGGCGATGAGGAGAAGGTTCGTATCTCGAGATACGAACCTTCTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-810s1c1
Sequence:CCGGGCCAGTGACACGTACTAAGATCTCGAGATCTTAGTACGTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-397s1c1
Sequence:CCGGGAAACTGCACTGCGAGCTTATCTCGAGATAAGCTCGCAGTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-254s1c1
Sequence:CCGGCAGAACATGGAGACTTGGGAACTCGAGTTCCCAAGTCTCCATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007604
VALIDATED
CAPZA2 MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, alpha 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-745s21c1
Sequence:CCGGACTGCCATCAGTGAGAATTATCTCGAGATAATTCTCACTGATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-1020s21c1
Sequence:CCGGAGCACAGAGCTTAGCTAATAACTCGAGTTATTAGCTAAGCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007604.2-51s21c1
Sequence:CCGGCGATGAGGAGAAGGTTCGTATCTCGAGATACGAACCTTCTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-127s21c1
Sequence:CCGGGATGTTCGATTATTGCTTAATCTCGAGATTAAGCAATAATCGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-664s21c1
Sequence:CCGGGATTCCCTCACAGTATCTAATCTCGAGATTAGATACTGTGAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-1310s21c1
Sequence:CCGGAGTAATGGGCACTCTAGTTAACTCGAGTTAACTAGAGTGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007604.2-397s21c1
Sequence:CCGGGAAACTGCACTGCGAGCTTATCTCGAGATAAGCTCGCAGTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007604.2-1805s1c1
Sequence:CCGGCCAGTGAATCATACACTATTTCTCGAGAAATAGTGTATGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-51s1c1
Sequence:CCGGCGATGAGGAGAAGGTTCGTATCTCGAGATACGAACCTTCTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-810s1c1
Sequence:CCGGGCCAGTGACACGTACTAAGATCTCGAGATCTTAGTACGTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-397s1c1
Sequence:CCGGGAAACTGCACTGCGAGCTTATCTCGAGATAAGCTCGCAGTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-254s1c1
Sequence:CCGGCAGAACATGGAGACTTGGGAACTCGAGTTCCCAAGTCTCCATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007604
VALIDATED
CAPZA2 MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, alpha 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-745s21c1
Sequence:CCGGACTGCCATCAGTGAGAATTATCTCGAGATAATTCTCACTGATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-1020s21c1
Sequence:CCGGAGCACAGAGCTTAGCTAATAACTCGAGTTATTAGCTAAGCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007604.2-51s21c1
Sequence:CCGGCGATGAGGAGAAGGTTCGTATCTCGAGATACGAACCTTCTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-127s21c1
Sequence:CCGGGATGTTCGATTATTGCTTAATCTCGAGATTAAGCAATAATCGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-664s21c1
Sequence:CCGGGATTCCCTCACAGTATCTAATCTCGAGATTAGATACTGTGAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007604.2-1310s21c1
Sequence:CCGGAGTAATGGGCACTCTAGTTAACTCGAGTTAACTAGAGTGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007604.2-397s21c1
Sequence:CCGGGAAACTGCACTGCGAGCTTATCTCGAGATAAGCTCGCAGTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007604.2-1805s1c1
Sequence:CCGGCCAGTGAATCATACACTATTTCTCGAGAAATAGTGTATGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-51s1c1
Sequence:CCGGCGATGAGGAGAAGGTTCGTATCTCGAGATACGAACCTTCTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-810s1c1
Sequence:CCGGGCCAGTGACACGTACTAAGATCTCGAGATCTTAGTACGTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-397s1c1
Sequence:CCGGGAAACTGCACTGCGAGCTTATCTCGAGATAAGCTCGCAGTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007604.2-254s1c1
Sequence:CCGGCAGAACATGGAGACTTGGGAACTCGAGTTCCCAAGTCTCCATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006136
VALIDATED
CAPZA2 MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, alpha 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-269s21c1
Sequence:CCGGCAGTATAACTTGGACCAGTTTCTCGAGAAACTGGTCCAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-208s21c1
Sequence:CCGGTGTTCGGTTACTGCTTAATAACTCGAGTTATTAAGCAGTAACCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006136.2-1110s21c1
Sequence:CCGGCTTAGCTAATCAACCATTATTCTCGAGAATAATGGTTGATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-132s21c1
Sequence:CCGGATGAAGAGAAGGTGCGTATAGCTCGAGCTATACGCACCTTCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-886s21c1
Sequence:CCGGGTTGCCAGTTACACGCACTAACTCGAGTTAGTGCGTGTAACTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006136.2-2040s1c1
Sequence:CCGGCCTGTGGTGAATGTTAGTATTCTCGAGAATACTAACATTCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-886s1c1
Sequence:CCGGGTTGCCAGTTACACGCACTAACTCGAGTTAGTGCGTGTAACTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-269s1c1
Sequence:CCGGCAGTATAACTTGGACCAGTTTCTCGAGAAACTGGTCCAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-889s1c1
Sequence:CCGGGCCAGTTACACGCACTAAGATCTCGAGATCTTAGTGCGTGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006136.2-556s1c1
Sequence:CCGGGCAAACCATTATTGCATGCATCTCGAGATGCATGCAATAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006136
VALIDATED
CAPZA2 MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, alpha 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-269s21c1
Sequence:CCGGCAGTATAACTTGGACCAGTTTCTCGAGAAACTGGTCCAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-208s21c1
Sequence:CCGGTGTTCGGTTACTGCTTAATAACTCGAGTTATTAAGCAGTAACCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006136.2-1110s21c1
Sequence:CCGGCTTAGCTAATCAACCATTATTCTCGAGAATAATGGTTGATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-132s21c1
Sequence:CCGGATGAAGAGAAGGTGCGTATAGCTCGAGCTATACGCACCTTCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-886s21c1
Sequence:CCGGGTTGCCAGTTACACGCACTAACTCGAGTTAGTGCGTGTAACTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006136.2-2040s1c1
Sequence:CCGGCCTGTGGTGAATGTTAGTATTCTCGAGAATACTAACATTCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-886s1c1
Sequence:CCGGGTTGCCAGTTACACGCACTAACTCGAGTTAGTGCGTGTAACTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-269s1c1
Sequence:CCGGCAGTATAACTTGGACCAGTTTCTCGAGAAACTGGTCCAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-889s1c1
Sequence:CCGGGCCAGTTACACGCACTAAGATCTCGAGATCTTAGTGCGTGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006136.2-556s1c1
Sequence:CCGGGCAAACCATTATTGCATGCATCTCGAGATGCATGCAATAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006136
VALIDATED
CAPZA2 MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, alpha 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-269s21c1
Sequence:CCGGCAGTATAACTTGGACCAGTTTCTCGAGAAACTGGTCCAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-208s21c1
Sequence:CCGGTGTTCGGTTACTGCTTAATAACTCGAGTTATTAAGCAGTAACCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006136.2-1110s21c1
Sequence:CCGGCTTAGCTAATCAACCATTATTCTCGAGAATAATGGTTGATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-132s21c1
Sequence:CCGGATGAAGAGAAGGTGCGTATAGCTCGAGCTATACGCACCTTCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006136.2-886s21c1
Sequence:CCGGGTTGCCAGTTACACGCACTAACTCGAGTTAGTGCGTGTAACTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006136.2-2040s1c1
Sequence:CCGGCCTGTGGTGAATGTTAGTATTCTCGAGAATACTAACATTCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-886s1c1
Sequence:CCGGGTTGCCAGTTACACGCACTAACTCGAGTTAGTGCGTGTAACTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-269s1c1
Sequence:CCGGCAGTATAACTTGGACCAGTTTCTCGAGAAACTGGTCCAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006136.2-889s1c1
Sequence:CCGGGCCAGTTACACGCACTAAGATCTCGAGATCTTAGTGCGTGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006136.2-556s1c1
Sequence:CCGGGCAAACCATTATTGCATGCATCTCGAGATGCATGCAATAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks