EMAIL THIS PAGE TO A FRIEND

CAPZA3

capping protein (actin filament) muscle Z-line, alpha 3

55 Gene Product Result for
Synonyms: CAPPA3 Gsg3
UniProtKB ID: Q96KX2, Q969J0
Gene ID:
Human(93661) Summary: This gene encodes an actin capping protein, one of the F-actin capping protein alpha subunit family. The encoded protein is predominantly localized to the neck region of ejaculated sperm, other immunohistochemical signals were found in the tail and postacrosomal regions. The encoded protein may also form heterodimers of alpha and beta subunits. This protein may be important in determining sperm architecture and male fertility. [provided by RefSeq, Jul 2008]
Mouse(12344) capping protein (actin filament) muscle Z-line, alpha 3
Rat(29324) capping protein (actin filament) muscle Z-line, alpha 3
sheep(101122590) capping protein (actin filament) muscle Z-line, alpha 3
domestic guinea pig(100716641) capping protein (actin filament) muscle Z-line, alpha 3
naked mole-rat(101708755) capping protein (actin filament) muscle Z-line, alpha 3
chicken(427929) capping protein (actin filament) muscle Z-line, alpha 3
dog(477680) capping protein (actin filament) muscle Z-line, alpha 3
cow(539160) capping protein (actin filament) muscle Z-line, alpha 3
domestic cat(101084548) capping protein (actin filament) muscle Z-line, alpha 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033328 Rosetta Predictions human pricing
NM_017164 Rosetta Predictions rat pricing
NM_007605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056893 predicted 364
2 SASI_Hs01_00056894 predicted 598
3 SASI_Hs01_00056895 predicted 743
4 SASI_Hs01_00056896 predicted 610
5 SASI_Hs01_00056897 predicted 380
6 SASI_Hs01_00056898 predicted 497
7 SASI_Hs01_00056899 predicted 734
8 SASI_Hs01_00056900 predicted 536
9 SASI_Hs01_00056901 predicted 810
10 SASI_Hs02_00361178 predicted 243
11 SASI_Hs01_00056902 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041600 predicted 332
2 SASI_Rn01_00041601 predicted 204
3 SASI_Rn01_00041602 predicted 893
4 SASI_Rn01_00041603 predicted 648
5 SASI_Rn01_00041604 predicted 939
6 SASI_Rn01_00041606 predicted 551
7 SASI_Rn01_00041607 predicted 823
8 SASI_Rn01_00041608 predicted 628
9 SASI_Rn01_00041609 predicted 454
10 SASI_Rn02_00261476 predicted 542
11 SASI_Rn01_00041605 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312049 predicted 656
2 SASI_Mm01_00050991 predicted 596
3 SASI_Mm02_00312050 predicted 480
4 SASI_Mm02_00312051 predicted 1027
5 SASI_Mm02_00312052 predicted 1021
6 SASI_Mm01_00050994 predicted 742
7 SASI_Mm02_00312053 predicted 671
8 SASI_Mm01_00050995 predicted 409
9 SASI_Mm01_00050996 predicted 1011
10 SASI_Mm02_00312054 predicted 489
11 SASI_Mm01_00050992 predicted 977
12 SASI_Mm01_00050993 predicted 965
13 SASI_Mm01_00050997 predicted 578
14 SASI_Mm01_00050998 predicted 697
15 SASI_Mm01_00050999 predicted 827
16 SASI_Mm01_00051000 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033328
CAPZA3 MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, alpha 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-706s1c1
Sequence:CCGGCCCAAGTAACGGGAAGAATATCTCGAGATATTCTTCCCGTTACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-495s1c1
Sequence:CCGGGAGGCAGAATACCTGAGAGTTCTCGAGAACTCTCAGGTATTCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-380s1c1
Sequence:CCGGCCACAATGTAATGGGCGACTACTCGAGTAGTCGCCCATTACATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-747s1c1
Sequence:CCGGAGGTGTGTCAACCTTCATATTCTCGAGAATATGAAGGTTGACACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-262s1c1
Sequence:CCGGGTCTGCTTATCCGTGATGAAACTCGAGTTTCATCACGGATAAGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033328.2-647s21c1
Sequence:CCGGAGAGTGCTGGAACGGACTTTGCTCGAGCAAAGTCCGTTCCAGCACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033328.2-469s21c1
Sequence:CCGGTCCAAAGTCATGGTATCATTCCTCGAGGAATGATACCATGACTTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033328
CAPZA3 MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, alpha 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-706s1c1
Sequence:CCGGCCCAAGTAACGGGAAGAATATCTCGAGATATTCTTCCCGTTACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-495s1c1
Sequence:CCGGGAGGCAGAATACCTGAGAGTTCTCGAGAACTCTCAGGTATTCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-380s1c1
Sequence:CCGGCCACAATGTAATGGGCGACTACTCGAGTAGTCGCCCATTACATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-747s1c1
Sequence:CCGGAGGTGTGTCAACCTTCATATTCTCGAGAATATGAAGGTTGACACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-262s1c1
Sequence:CCGGGTCTGCTTATCCGTGATGAAACTCGAGTTTCATCACGGATAAGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033328.2-647s21c1
Sequence:CCGGAGAGTGCTGGAACGGACTTTGCTCGAGCAAAGTCCGTTCCAGCACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033328.2-469s21c1
Sequence:CCGGTCCAAAGTCATGGTATCATTCCTCGAGGAATGATACCATGACTTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033328
CAPZA3 MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, alpha 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-706s1c1
Sequence:CCGGCCCAAGTAACGGGAAGAATATCTCGAGATATTCTTCCCGTTACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-495s1c1
Sequence:CCGGGAGGCAGAATACCTGAGAGTTCTCGAGAACTCTCAGGTATTCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-380s1c1
Sequence:CCGGCCACAATGTAATGGGCGACTACTCGAGTAGTCGCCCATTACATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-747s1c1
Sequence:CCGGAGGTGTGTCAACCTTCATATTCTCGAGAATATGAAGGTTGACACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033328.2-262s1c1
Sequence:CCGGGTCTGCTTATCCGTGATGAAACTCGAGTTTCATCACGGATAAGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033328.2-647s21c1
Sequence:CCGGAGAGTGCTGGAACGGACTTTGCTCGAGCAAAGTCCGTTCCAGCACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033328.2-469s21c1
Sequence:CCGGTCCAAAGTCATGGTATCATTCCTCGAGGAATGATACCATGACTTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007605
CAPZA3 MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007605.2-1070s1c1
Sequence:CCGGAGTAAGTGCTTGGATAGAGTTCTCGAGAACTCTATCCAAGCACTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-477s1c1
Sequence:CCGGCCGTTGTTATGTGTGCCTTAACTCGAGTTAAGGCACACATAACAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-669s1c1
Sequence:CCGGCCCAAGTCACAGGGAGAATTTCTCGAGAAATTCTCCCTGTGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-465s1c1
Sequence:CCGGAGTACATAAGATCCGTTGTTACTCGAGTAACAACGGATCTTATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-833s1c1
Sequence:CCGGGCTGCTGTCATAGAAGAACTACTCGAGTAGTTCTTCTATGACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007605
CAPZA3 MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007605.2-1070s1c1
Sequence:CCGGAGTAAGTGCTTGGATAGAGTTCTCGAGAACTCTATCCAAGCACTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-477s1c1
Sequence:CCGGCCGTTGTTATGTGTGCCTTAACTCGAGTTAAGGCACACATAACAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-669s1c1
Sequence:CCGGCCCAAGTCACAGGGAGAATTTCTCGAGAAATTCTCCCTGTGACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-465s1c1
Sequence:CCGGAGTACATAAGATCCGTTGTTACTCGAGTAACAACGGATCTTATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-833s1c1
Sequence:CCGGGCTGCTGTCATAGAAGAACTACTCGAGTAGTTCTTCTATGACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007605
CAPZA3 MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007605.2-1070s1c1
Sequence:CCGGAGTAAGTGCTTGGATAGAGTTCTCGAGAACTCTATCCAAGCACTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-477s1c1
Sequence:CCGGCCGTTGTTATGTGTGCCTTAACTCGAGTTAAGGCACACATAACAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-669s1c1
Sequence:CCGGCCCAAGTCACAGGGAGAATTTCTCGAGAAATTCTCCCTGTGACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-465s1c1
Sequence:CCGGAGTACATAAGATCCGTTGTTACTCGAGTAACAACGGATCTTATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007605.2-833s1c1
Sequence:CCGGGCTGCTGTCATAGAAGAACTACTCGAGTAGTTCTTCTATGACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)