EMAIL THIS PAGE TO A FRIEND

CAPZB

capping protein (actin filament) muscle Z-line, beta

105 Gene Product Result for
Synonyms: CAPB CAPPB CAPZ
UniProtKB ID: P47756, Q32Q68, Q5U0L4, Q8TB49, Q9NUC4
Gene ID:
Human(832) Summary: This gene encodes the beta subunit of the barbed-end actin binding protein, which belongs to the F-actin capping protein family. The capping protein is a heterodimeric actin capping protein that blocks actin filament assembly and disassembly at the fast growing (barbed) filament ends and functions in regulating actin filament dynamics as well as in stabilizing actin filament lengths in muscle and nonmuscle cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, Apr 2011]
Mouse(12345) capping protein (actin filament) muscle Z-line, beta
Rat(298584) capping protein (actin filament) muscle Z-line, beta
Zebrafish(335083) capping protein (actin filament) muscle Z-line, beta
chicken(396418) capping protein (actin filament) muscle Z-line, beta
dog(478209) capping protein (actin filament) muscle Z-line, beta
cow(338052) capping protein (actin filament) muscle Z-line, beta
domestic cat(101090785) capping protein (actin filament) muscle Z-line, beta
naked mole-rat(101706752) capping protein (actin filament) muscle Z-line, beta
domestic guinea pig(100733325) capping protein (actin filament) muscle Z-line, beta
sheep(101108893) capping protein (actin filament) muscle Z-line, beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004930 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004930 Rosetta Predictions human pricing
NM_001005903 Rosetta Predictions rat pricing
NM_001037761 Rosetta Predictions mouse pricing
NM_009798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025777 predicted 911
2 SASI_Hs01_00025778 predicted 869
3 SASI_Hs01_00025779 predicted 500
4 SASI_Hs01_00025780 predicted 729
5 SASI_Hs01_00025781 predicted 913
6 SASI_Hs01_00025782 predicted 740
7 SASI_Hs01_00025783 predicted 441
8 SASI_Hs01_00025784 predicted 738
9 SASI_Hs01_00025785 predicted 366
10 SASI_Hs01_00025786 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060401 predicted 461
2 SASI_Rn01_00060402 predicted 886
3 SASI_Rn01_00060403 predicted 765
4 SASI_Rn01_00060404 predicted 396
5 SASI_Rn01_00060405 predicted 819
6 SASI_Rn01_00060406 predicted 673
7 SASI_Rn01_00060407 predicted 878
8 SASI_Rn01_00060408 predicted 808
9 SASI_Rn01_00060409 predicted 663
10 SASI_Rn01_00060410 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289435 predicted 309
2 SASI_Mm01_00192032 predicted 355
3 SASI_Mm01_00192033 predicted 464
4 SASI_Mm01_00192034 predicted 433
5 SASI_Mm01_00192035 predicted 279
6 SASI_Mm01_00192036 predicted 429
7 SASI_Mm01_00192037 predicted 398
8 SASI_Mm01_00192038 predicted 427
9 SASI_Mm01_00192039 predicted 488
10 SASI_Mm01_00192040 predicted 395
11 SASI_Mm01_00192041 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317070 predicted 356
2 SASI_Mm01_00156346 predicted 409
3 SASI_Mm01_00156347 predicted 509
4 SASI_Mm01_00156348 predicted 479
5 SASI_Mm01_00156349 predicted 324
6 SASI_Mm01_00156350 predicted 473
7 SASI_Mm01_00156351 predicted 446
8 SASI_Mm01_00156352 predicted 476
9 SASI_Mm01_00156353 predicted 533
10 SASI_Mm01_00156354 predicted 440
11 SASI_Mm01_00156355 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009798
CAPZB MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-843s21c1
Sequence:CCGGGCAGACAAATCAAAGCAAGAACTCGAGTTCTTGCTTTGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009798.3-940s21c1
Sequence:CCGGCACGCCATGCACTCGTTAGGTCTCGAGACCTAACGAGTGCATGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-306s21c1
Sequence:CCGGTATAGGTCACCGTGGAGTAACCTCGAGGTTACTCCACGGTGACCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-511s21c1
Sequence:CCGGATGGATCCAAGAAGATCAAAGCTCGAGCTTTGATCTTCTTGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-831s21c1
Sequence:CCGGGTGCAGACGTTTGCAGACAAACTCGAGTTTGTCTGCAAACGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-754s1c1
Sequence:CCGGGTGCAGACGTTTGCAGACAAACTCGAGTTTGTCTGCAAACGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-766s1c1
Sequence:CCGGGCAGACAAATCAAAGCAAGAACTCGAGTTCTTGCTTTGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009798.1-863s1c1
Sequence:CCGGCACGCCATGCACTCGTTAGGTCTCGAGACCTAACGAGTGCATGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-292s1c1
Sequence:CCGGCGGCTCAGAAAGCTGGAGGTACTCGAGTACCTCCAGCTTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009798
CAPZB MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-843s21c1
Sequence:CCGGGCAGACAAATCAAAGCAAGAACTCGAGTTCTTGCTTTGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009798.3-940s21c1
Sequence:CCGGCACGCCATGCACTCGTTAGGTCTCGAGACCTAACGAGTGCATGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-306s21c1
Sequence:CCGGTATAGGTCACCGTGGAGTAACCTCGAGGTTACTCCACGGTGACCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-511s21c1
Sequence:CCGGATGGATCCAAGAAGATCAAAGCTCGAGCTTTGATCTTCTTGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-831s21c1
Sequence:CCGGGTGCAGACGTTTGCAGACAAACTCGAGTTTGTCTGCAAACGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-754s1c1
Sequence:CCGGGTGCAGACGTTTGCAGACAAACTCGAGTTTGTCTGCAAACGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-766s1c1
Sequence:CCGGGCAGACAAATCAAAGCAAGAACTCGAGTTCTTGCTTTGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009798.1-863s1c1
Sequence:CCGGCACGCCATGCACTCGTTAGGTCTCGAGACCTAACGAGTGCATGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-292s1c1
Sequence:CCGGCGGCTCAGAAAGCTGGAGGTACTCGAGTACCTCCAGCTTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009798
CAPZB MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-843s21c1
Sequence:CCGGGCAGACAAATCAAAGCAAGAACTCGAGTTCTTGCTTTGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009798.3-940s21c1
Sequence:CCGGCACGCCATGCACTCGTTAGGTCTCGAGACCTAACGAGTGCATGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-306s21c1
Sequence:CCGGTATAGGTCACCGTGGAGTAACCTCGAGGTTACTCCACGGTGACCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-511s21c1
Sequence:CCGGATGGATCCAAGAAGATCAAAGCTCGAGCTTTGATCTTCTTGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009798.3-831s21c1
Sequence:CCGGGTGCAGACGTTTGCAGACAAACTCGAGTTTGTCTGCAAACGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-754s1c1
Sequence:CCGGGTGCAGACGTTTGCAGACAAACTCGAGTTTGTCTGCAAACGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-766s1c1
Sequence:CCGGGCAGACAAATCAAAGCAAGAACTCGAGTTCTTGCTTTGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009798.1-863s1c1
Sequence:CCGGCACGCCATGCACTCGTTAGGTCTCGAGACCTAACGAGTGCATGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009798.1-292s1c1
Sequence:CCGGCGGCTCAGAAAGCTGGAGGTACTCGAGTACCTCCAGCTTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004930
VALIDATED
CAPZB MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament) muscle Z-line, beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-744s21c1
Sequence:CCGGGAACGAGATCTACTTTGGAAACTCGAGTTTCCAAAGTAGATCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-704s21c1
Sequence:CCGGGCCTGGTAGAGGACATGGAAACTCGAGTTTCCATGTCCTCTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004930.2-373s21c1
Sequence:CCGGGACCAGTATCGAGACCTGTATCTCGAGATACAGGTCTCGATACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-474s21c1
Sequence:CCGGAGATGGATCAAAGAAGATCAACTCGAGTTGATCTTCTTTGATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-414s1c1
Sequence:CCGGAGATGGATCAAAGAAGATCAACTCGAGTTGATCTTCTTTGATCCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-684s1c1
Sequence:CCGGGAACGAGATCTACTTTGGAAACTCGAGTTTCCAAAGTAGATCTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-313s1c1
Sequence:CCGGGACCAGTATCGAGACCTGTATCTCGAGATACAGGTCTCGATACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-209s1c1
Sequence:CCGGCCTATAGGTCACCATGGAGTACTCGAGTACTCCATGGTGACCTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-644s1c1
Sequence:CCGGGCCTGGTAGAGGACATGGAAACTCGAGTTTCCATGTCCTCTACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004930
VALIDATED
CAPZB MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament) muscle Z-line, beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-744s21c1
Sequence:CCGGGAACGAGATCTACTTTGGAAACTCGAGTTTCCAAAGTAGATCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-704s21c1
Sequence:CCGGGCCTGGTAGAGGACATGGAAACTCGAGTTTCCATGTCCTCTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004930.2-373s21c1
Sequence:CCGGGACCAGTATCGAGACCTGTATCTCGAGATACAGGTCTCGATACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-474s21c1
Sequence:CCGGAGATGGATCAAAGAAGATCAACTCGAGTTGATCTTCTTTGATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-414s1c1
Sequence:CCGGAGATGGATCAAAGAAGATCAACTCGAGTTGATCTTCTTTGATCCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-684s1c1
Sequence:CCGGGAACGAGATCTACTTTGGAAACTCGAGTTTCCAAAGTAGATCTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-313s1c1
Sequence:CCGGGACCAGTATCGAGACCTGTATCTCGAGATACAGGTCTCGATACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-209s1c1
Sequence:CCGGCCTATAGGTCACCATGGAGTACTCGAGTACTCCATGGTGACCTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-644s1c1
Sequence:CCGGGCCTGGTAGAGGACATGGAAACTCGAGTTTCCATGTCCTCTACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004930
VALIDATED
CAPZB MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament) muscle Z-line, beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-744s21c1
Sequence:CCGGGAACGAGATCTACTTTGGAAACTCGAGTTTCCAAAGTAGATCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-704s21c1
Sequence:CCGGGCCTGGTAGAGGACATGGAAACTCGAGTTTCCATGTCCTCTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004930.2-373s21c1
Sequence:CCGGGACCAGTATCGAGACCTGTATCTCGAGATACAGGTCTCGATACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004930.2-474s21c1
Sequence:CCGGAGATGGATCAAAGAAGATCAACTCGAGTTGATCTTCTTTGATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-414s1c1
Sequence:CCGGAGATGGATCAAAGAAGATCAACTCGAGTTGATCTTCTTTGATCCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-684s1c1
Sequence:CCGGGAACGAGATCTACTTTGGAAACTCGAGTTTCCAAAGTAGATCTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-313s1c1
Sequence:CCGGGACCAGTATCGAGACCTGTATCTCGAGATACAGGTCTCGATACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-209s1c1
Sequence:CCGGCCTATAGGTCACCATGGAGTACTCGAGTACTCCATGGTGACCTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004930.1-644s1c1
Sequence:CCGGGCCTGGTAGAGGACATGGAAACTCGAGTTTCCATGTCCTCTACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks