EMAIL THIS PAGE TO A FRIEND

CARD10

caspase recruitment domain family, member 10

96 Gene Product Result for
Synonyms: BIMP1 CARMA3
UniProtKB ID: Q9BWT7, Q14CQ8, Q5TFG6, Q9UGR5, Q9UGR6, Q9Y3H0
Gene ID:
Human(29775) Summary: The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]
Mouse(105844) caspase recruitment domain family, member 10
Rat(315120) caspase recruitment domain family, member 10
sheep(101108123) caspase recruitment domain family, member 10
naked mole-rat(101721933) caspase recruitment domain family, member 10
domestic guinea pig(100732019) caspase recruitment domain family, member 10
chicken(418041) caspase recruitment domain family, member 10
dog(481268) caspase recruitment domain family, member 10
domestic cat(101093117) caspase recruitment domain family, member 10
cow(535188) caspase recruitment domain family, member 10
Horse(100069777) caspase recruitment domain family, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014550 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015931 MISSION® esiRNA esiRNA targeting human CARD10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014550 Rosetta Predictions human pricing
NM_001130554 Rosetta Predictions rat pricing
NM_130859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170195 predicted 1230
2 SASI_Hs01_00170196 predicted 394
3 SASI_Hs01_00170197 predicted 2308
4 SASI_Hs01_00170198 predicted 1656
5 SASI_Hs01_00170199 predicted 3442
6 SASI_Hs01_00170200 predicted 2079
7 SASI_Hs02_00345812 predicted 2213
8 SASI_Hs01_00170202 predicted 2495
9 SASI_Hs01_00170203 predicted 2140
10 SASI_Hs01_00170204 predicted 3496
11 SASI_Hs01_00170201 predicted 3358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255709 predicted 2147
2 SASI_Rn02_00255710 predicted 450
3 SASI_Rn02_00255711 predicted 756
4 SASI_Rn02_00255712 predicted 1572
5 SASI_Rn02_00255713 predicted 1084
6 SASI_Rn02_00255714 predicted 2853
7 SASI_Rn02_00255715 predicted 2235
8 SASI_Rn02_00255716 predicted 2585
9 SASI_Rn02_00255717 predicted 2634
10 SASI_Rn02_00255718 predicted 2312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090916 predicted 2288
2 SASI_Mm01_00090917 predicted 3298
3 SASI_Mm01_00090918 predicted 595
4 SASI_Mm01_00090919 predicted 1357
5 SASI_Mm01_00090920 predicted 1717
6 SASI_Mm02_00338275 predicted 3005
7 SASI_Mm01_00090921 predicted 2459
8 SASI_Mm01_00090922 predicted 1125
9 SASI_Mm01_00090923 predicted 1825
10 SASI_Mm01_00090924 predicted 559
11 SASI_Mm01_00090925 predicted 1243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014550
VALIDATED
CARD10 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 10
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014550.3-3425s1c1
Sequence:CCGGGCAGGTTTGCACACTCAAGTTCTCGAGAACTTGAGTGTGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-2316s1c1
Sequence:CCGGGCTCCTAGAAGTTCAGGAGAACTCGAGTTCTCCTGAACTTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-2118s1c1
Sequence:CCGGGCCCTTCTACATTCGTGCCAACTCGAGTTGGCACGAATGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-358s1c1
Sequence:CCGGCGCTGCTCCATGATCCTCGATCTCGAGATCGAGGATCATGGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-2316s21c1
Sequence:CCGGGCTCCTAGAAGTTCAGGAGAACTCGAGTTCTCCTGAACTTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014550.3-3372s21c1
Sequence:CCGGGTCTGTGTCTTCTCCTTAAACCTCGAGGTTTAAGGAGAAGACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-704s21c1
Sequence:CCGGTGGATCAGCTCAAGCTCAAAGCTCGAGCTTTGAGCTTGAGCTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-358s21c1
Sequence:CCGGCGCTGCTCCATGATCCTCGATCTCGAGATCGAGGATCATGGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-1784s21c1
Sequence:CCGGTCAACAGGTCTCTGGCTATTCCTCGAGGAATAGCCAGAGACCTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014550.3-3426s21c1
Sequence:CCGGCAGGTTTGCACACTCAAGTTCCTCGAGGAACTTGAGTGTGCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-390s21c1
Sequence:CCGGTGAGGGCCTGACCCAATTCTTCTCGAGAAGAATTGGGTCAGGCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014550
VALIDATED
CARD10 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 10
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014550.3-3425s1c1
Sequence:CCGGGCAGGTTTGCACACTCAAGTTCTCGAGAACTTGAGTGTGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-2316s1c1
Sequence:CCGGGCTCCTAGAAGTTCAGGAGAACTCGAGTTCTCCTGAACTTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-2118s1c1
Sequence:CCGGGCCCTTCTACATTCGTGCCAACTCGAGTTGGCACGAATGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-358s1c1
Sequence:CCGGCGCTGCTCCATGATCCTCGATCTCGAGATCGAGGATCATGGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-2316s21c1
Sequence:CCGGGCTCCTAGAAGTTCAGGAGAACTCGAGTTCTCCTGAACTTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014550.3-3372s21c1
Sequence:CCGGGTCTGTGTCTTCTCCTTAAACCTCGAGGTTTAAGGAGAAGACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-704s21c1
Sequence:CCGGTGGATCAGCTCAAGCTCAAAGCTCGAGCTTTGAGCTTGAGCTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-358s21c1
Sequence:CCGGCGCTGCTCCATGATCCTCGATCTCGAGATCGAGGATCATGGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-1784s21c1
Sequence:CCGGTCAACAGGTCTCTGGCTATTCCTCGAGGAATAGCCAGAGACCTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014550.3-3426s21c1
Sequence:CCGGCAGGTTTGCACACTCAAGTTCCTCGAGGAACTTGAGTGTGCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-390s21c1
Sequence:CCGGTGAGGGCCTGACCCAATTCTTCTCGAGAAGAATTGGGTCAGGCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014550
VALIDATED
CARD10 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 10
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014550.3-3425s1c1
Sequence:CCGGGCAGGTTTGCACACTCAAGTTCTCGAGAACTTGAGTGTGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-2316s1c1
Sequence:CCGGGCTCCTAGAAGTTCAGGAGAACTCGAGTTCTCCTGAACTTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-2118s1c1
Sequence:CCGGGCCCTTCTACATTCGTGCCAACTCGAGTTGGCACGAATGTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014550.3-358s1c1
Sequence:CCGGCGCTGCTCCATGATCCTCGATCTCGAGATCGAGGATCATGGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-2316s21c1
Sequence:CCGGGCTCCTAGAAGTTCAGGAGAACTCGAGTTCTCCTGAACTTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014550.3-3372s21c1
Sequence:CCGGGTCTGTGTCTTCTCCTTAAACCTCGAGGTTTAAGGAGAAGACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-704s21c1
Sequence:CCGGTGGATCAGCTCAAGCTCAAAGCTCGAGCTTTGAGCTTGAGCTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-358s21c1
Sequence:CCGGCGCTGCTCCATGATCCTCGATCTCGAGATCGAGGATCATGGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-1784s21c1
Sequence:CCGGTCAACAGGTCTCTGGCTATTCCTCGAGGAATAGCCAGAGACCTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014550.3-3426s21c1
Sequence:CCGGCAGGTTTGCACACTCAAGTTCCTCGAGGAACTTGAGTGTGCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014550.3-390s21c1
Sequence:CCGGTGAGGGCCTGACCCAATTCTTCTCGAGAAGAATTGGGTCAGGCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130859
VALIDATED
CARD10 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 10
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-1409s1c1
Sequence:CCGGCAGTATTCTCAGAGCCTCATTCTCGAGAATGAGGCTCTGAGAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-1408s1c1
Sequence:CCGGGCAGTATTCTCAGAGCCTCATCTCGAGATGAGGCTCTGAGAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-597s1c1
Sequence:CCGGGCCTGACTCAGTTCTTGATGACTCGAGTCATCAAGAACTGAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-2016s1c1
Sequence:CCGGCCCAGGATAAGAGTCCAGATACTCGAGTATCTGGACTCTTATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-807s1c1
Sequence:CCGGGCCTCAAGGATGAGAACTACACTCGAGTGTAGTTCTCATCCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-3307s21c1
Sequence:CCGGTCTAGACCTCCTCCATCAGATCTCGAGATCTGATGGAGGAGGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-1721s21c1
Sequence:CCGGGAGATCAACCGGCTCTCTATCCTCGAGGATAGAGAGCCGGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-1945s21c1
Sequence:CCGGTGGCCTGGACTTCCTCAATAGCTCGAGCTATTGAGGAAGTCCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-638s21c1
Sequence:CCGGGAAGCTCGGAAGAGCCAATTGCTCGAGCAATTGGCTCTTCCGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-3331s21c1
Sequence:CCGGTAGGCCTCCTCCATCAGATACCTCGAGGTATCTGATGGAGGAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1395s21c1
Sequence:CCGGACCGGATCCAGCTGCAGTATTCTCGAGAATACTGCAGCTGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1817s21c1
Sequence:CCGGTTTAGCAGCATGTCGGATATCCTCGAGGATATCCGACATGCTGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1300s21c1
Sequence:CCGGGAAGGACTGTGACCTCTATAACTCGAGTTATAGAGGTCACAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-2644s21c1
Sequence:CCGGAGAGCTAGAACGAAGCCTAAACTCGAGTTTAGGCTTCGTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-4496s21c1
Sequence:CCGGTCGTCCCTCATCCCGTGTAAACTCGAGTTTACACGGGATGAGGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130859
VALIDATED
CARD10 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 10
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-1409s1c1
Sequence:CCGGCAGTATTCTCAGAGCCTCATTCTCGAGAATGAGGCTCTGAGAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-1408s1c1
Sequence:CCGGGCAGTATTCTCAGAGCCTCATCTCGAGATGAGGCTCTGAGAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-597s1c1
Sequence:CCGGGCCTGACTCAGTTCTTGATGACTCGAGTCATCAAGAACTGAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-2016s1c1
Sequence:CCGGCCCAGGATAAGAGTCCAGATACTCGAGTATCTGGACTCTTATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-807s1c1
Sequence:CCGGGCCTCAAGGATGAGAACTACACTCGAGTGTAGTTCTCATCCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-3307s21c1
Sequence:CCGGTCTAGACCTCCTCCATCAGATCTCGAGATCTGATGGAGGAGGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-1721s21c1
Sequence:CCGGGAGATCAACCGGCTCTCTATCCTCGAGGATAGAGAGCCGGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-1945s21c1
Sequence:CCGGTGGCCTGGACTTCCTCAATAGCTCGAGCTATTGAGGAAGTCCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-638s21c1
Sequence:CCGGGAAGCTCGGAAGAGCCAATTGCTCGAGCAATTGGCTCTTCCGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-3331s21c1
Sequence:CCGGTAGGCCTCCTCCATCAGATACCTCGAGGTATCTGATGGAGGAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1395s21c1
Sequence:CCGGACCGGATCCAGCTGCAGTATTCTCGAGAATACTGCAGCTGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1817s21c1
Sequence:CCGGTTTAGCAGCATGTCGGATATCCTCGAGGATATCCGACATGCTGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1300s21c1
Sequence:CCGGGAAGGACTGTGACCTCTATAACTCGAGTTATAGAGGTCACAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-2644s21c1
Sequence:CCGGAGAGCTAGAACGAAGCCTAAACTCGAGTTTAGGCTTCGTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-4496s21c1
Sequence:CCGGTCGTCCCTCATCCCGTGTAAACTCGAGTTTACACGGGATGAGGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130859
VALIDATED
CARD10 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 10
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-1409s1c1
Sequence:CCGGCAGTATTCTCAGAGCCTCATTCTCGAGAATGAGGCTCTGAGAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-1408s1c1
Sequence:CCGGGCAGTATTCTCAGAGCCTCATCTCGAGATGAGGCTCTGAGAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-597s1c1
Sequence:CCGGGCCTGACTCAGTTCTTGATGACTCGAGTCATCAAGAACTGAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-2016s1c1
Sequence:CCGGCCCAGGATAAGAGTCCAGATACTCGAGTATCTGGACTCTTATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130859.2-807s1c1
Sequence:CCGGGCCTCAAGGATGAGAACTACACTCGAGTGTAGTTCTCATCCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-3307s21c1
Sequence:CCGGTCTAGACCTCCTCCATCAGATCTCGAGATCTGATGGAGGAGGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-1721s21c1
Sequence:CCGGGAGATCAACCGGCTCTCTATCCTCGAGGATAGAGAGCCGGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-1945s21c1
Sequence:CCGGTGGCCTGGACTTCCTCAATAGCTCGAGCTATTGAGGAAGTCCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-638s21c1
Sequence:CCGGGAAGCTCGGAAGAGCCAATTGCTCGAGCAATTGGCTCTTCCGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-3331s21c1
Sequence:CCGGTAGGCCTCCTCCATCAGATACCTCGAGGTATCTGATGGAGGAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1395s21c1
Sequence:CCGGACCGGATCCAGCTGCAGTATTCTCGAGAATACTGCAGCTGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1817s21c1
Sequence:CCGGTTTAGCAGCATGTCGGATATCCTCGAGGATATCCGACATGCTGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130859.2-1300s21c1
Sequence:CCGGGAAGGACTGTGACCTCTATAACTCGAGTTATAGAGGTCACAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130859.2-2644s21c1
Sequence:CCGGAGAGCTAGAACGAAGCCTAAACTCGAGTTTAGGCTTCGTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130859.2-4496s21c1
Sequence:CCGGTCGTCCCTCATCCCGTGTAAACTCGAGTTTACACGGGATGAGGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks