EMAIL THIS PAGE TO A FRIEND

CARD11

caspase recruitment domain family, member 11

65 Gene Product Result for
Synonyms: BENTA BIMP3 CARMA1 PPBL
UniProtKB ID: Q9BXL7, A4D1Z7, Q2NKN7, Q548H3
Gene ID:
Human(84433) Summary: The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
Mouse(108723) caspase recruitment domain family, member 11
Rat(304314) caspase recruitment domain family, member 11
chicken(416476) caspase recruitment domain family, member 11
domestic cat(101093566) caspase recruitment domain family, member 11
cow(515377) caspase recruitment domain family, member 11
dog(489887) caspase recruitment domain family, member 11
domestic guinea pig(100725653) caspase recruitment domain family, member 11
naked mole-rat(101696328) caspase recruitment domain family, member 11
sheep(101110813) caspase recruitment domain family, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032415 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032415 Rosetta Predictions human pricing
XM_001073551 Rosetta Predictions rat pricing
XM_221961 Rosetta Predictions rat pricing
NM_175362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359811 predicted 1098
2 SASI_Hs01_00172040 predicted 1093
3 SASI_Hs01_00172041 predicted 1459
4 SASI_Hs01_00172043 predicted 3412
5 SASI_Hs01_00172044 predicted 3409
6 SASI_Hs01_00172045 predicted 657
7 SASI_Hs01_00172046 predicted 933
8 SASI_Hs01_00172047 predicted 1134
9 SASI_Hs01_00172048 predicted 1895
10 SASI_Hs02_00359812 predicted 1799
11 SASI_Hs01_00172039 predicted 2924
12 SASI_Hs01_00172042 predicted 1670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343144 predicted 1004
2 SASI_Rn02_00343145 predicted 3030
3 SASI_Rn02_00343146 predicted 2652
4 SASI_Rn02_00343147 predicted 2721
5 SASI_Rn02_00343148 predicted 2336
6 SASI_Rn02_00343149 predicted 1481
7 SASI_Rn02_00343150 predicted 1045
8 SASI_Rn02_00343151 predicted 3360
9 SASI_Rn02_00343152 predicted 2395
10 SASI_Rn02_00343153 predicted 2111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169588 predicted 294
2 SASI_Rn01_00169589 predicted 440
3 SASI_Rn01_00169590 predicted 504
4 SASI_Rn01_00169591 predicted 602
5 SASI_Rn01_00169592 predicted 1811
6 SASI_Rn01_00169593 predicted 1379
7 SASI_Rn01_00169594 predicted 620
8 SASI_Rn01_00169595 predicted 900
9 SASI_Rn01_00169596 predicted 1747
10 SASI_Rn01_00169597 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157251 predicted 2561
2 SASI_Mm01_00157252 predicted 3323
3 SASI_Mm02_00346161 predicted 3831
4 SASI_Mm01_00157253 predicted 3349
5 SASI_Mm01_00157254 predicted 1489
6 SASI_Mm01_00157255 predicted 2017
7 SASI_Mm01_00157256 predicted 2237
8 SASI_Mm01_00157257 predicted 2549
9 SASI_Mm01_00157258 predicted 1210
10 SASI_Mm01_00157259 predicted 2322
11 SASI_Mm01_00157260 predicted 2938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175362
CARD11 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 11
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1001s21c1
Sequence:CCGGTCGAGATCGACCAGCTCAAACCTCGAGGTTTGAGCTGGTCGATCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-488s21c1
Sequence:CCGGATGAAGACGAGGTGCTCAATGCTCGAGCATTGAGCACCTCGTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175362.2-3889s21c1
Sequence:CCGGGCGTGAACAGAGATGAGCAACCTCGAGGTTGCTCATCTCTGTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1495s21c1
Sequence:CCGGCAGTACTCACAGTGCTTAATCCTCGAGGATTAAGCACTGTGAGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-2035s21c1
Sequence:CCGGTCCATAGTCAGACGCTGTAAGCTCGAGCTTACAGCGTCTGACTATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1772s21c1
Sequence:CCGGCCGAAGACAGCAAGTACTTTCCTCGAGGAAAGTACTTGCTGTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175362.2-3934s21c1
Sequence:CCGGGCAACCAGAGCAGCAGTTGAACTCGAGTTCAACTGCTGCTCTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1559s21c1
Sequence:CCGGAGAACGATGAGATGCGTATTGCTCGAGCAATACGCATCTCATCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1629s1c1
Sequence:CCGGGCCAGGAAGCTGATGATTCTTCTCGAGAAGAATCATCAGCTTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175362.1-3745s1c1
Sequence:CCGGCCTAGCAACAAAGTTACCAGACTCGAGTCTGGTAACTTTGTTGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-814s1c1
Sequence:CCGGCGACAACTACAACTTAGCCATCTCGAGATGGCTAAGTTGTAGTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-2467s1c1
Sequence:CCGGCCTCATCACTCTGCATTACAACTCGAGTTGTAATGCAGAGTGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1303s1c1
Sequence:CCGGGCACCGCATGAACACAGTTATCTCGAGATAACTGTGTTCATGCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1667s1c1
Sequence:CCGGCCCGAAGACAGCAAGTACTTTCTCGAGAAAGTACTTGCTGTCTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-3243s1c1
Sequence:CCGGGCAAGTCAGATATTGTCACAACTCGAGTTGTGACAATATCTGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-2025s1c1
Sequence:CCGGCCTTAGACCTTGACGATGAAACTCGAGTTTCATCGTCAAGGTCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175362
CARD11 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 11
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1001s21c1
Sequence:CCGGTCGAGATCGACCAGCTCAAACCTCGAGGTTTGAGCTGGTCGATCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-488s21c1
Sequence:CCGGATGAAGACGAGGTGCTCAATGCTCGAGCATTGAGCACCTCGTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175362.2-3889s21c1
Sequence:CCGGGCGTGAACAGAGATGAGCAACCTCGAGGTTGCTCATCTCTGTTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1495s21c1
Sequence:CCGGCAGTACTCACAGTGCTTAATCCTCGAGGATTAAGCACTGTGAGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-2035s21c1
Sequence:CCGGTCCATAGTCAGACGCTGTAAGCTCGAGCTTACAGCGTCTGACTATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1772s21c1
Sequence:CCGGCCGAAGACAGCAAGTACTTTCCTCGAGGAAAGTACTTGCTGTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175362.2-3934s21c1
Sequence:CCGGGCAACCAGAGCAGCAGTTGAACTCGAGTTCAACTGCTGCTCTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1559s21c1
Sequence:CCGGAGAACGATGAGATGCGTATTGCTCGAGCAATACGCATCTCATCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1629s1c1
Sequence:CCGGGCCAGGAAGCTGATGATTCTTCTCGAGAAGAATCATCAGCTTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175362.1-3745s1c1
Sequence:CCGGCCTAGCAACAAAGTTACCAGACTCGAGTCTGGTAACTTTGTTGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-814s1c1
Sequence:CCGGCGACAACTACAACTTAGCCATCTCGAGATGGCTAAGTTGTAGTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-2467s1c1
Sequence:CCGGCCTCATCACTCTGCATTACAACTCGAGTTGTAATGCAGAGTGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1303s1c1
Sequence:CCGGGCACCGCATGAACACAGTTATCTCGAGATAACTGTGTTCATGCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1667s1c1
Sequence:CCGGCCCGAAGACAGCAAGTACTTTCTCGAGAAAGTACTTGCTGTCTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-3243s1c1
Sequence:CCGGGCAAGTCAGATATTGTCACAACTCGAGTTGTGACAATATCTGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-2025s1c1
Sequence:CCGGCCTTAGACCTTGACGATGAAACTCGAGTTTCATCGTCAAGGTCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175362
CARD11 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 11
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1001s21c1
Sequence:CCGGTCGAGATCGACCAGCTCAAACCTCGAGGTTTGAGCTGGTCGATCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-488s21c1
Sequence:CCGGATGAAGACGAGGTGCTCAATGCTCGAGCATTGAGCACCTCGTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175362.2-3889s21c1
Sequence:CCGGGCGTGAACAGAGATGAGCAACCTCGAGGTTGCTCATCTCTGTTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1495s21c1
Sequence:CCGGCAGTACTCACAGTGCTTAATCCTCGAGGATTAAGCACTGTGAGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-2035s21c1
Sequence:CCGGTCCATAGTCAGACGCTGTAAGCTCGAGCTTACAGCGTCTGACTATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1772s21c1
Sequence:CCGGCCGAAGACAGCAAGTACTTTCCTCGAGGAAAGTACTTGCTGTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175362.2-3934s21c1
Sequence:CCGGGCAACCAGAGCAGCAGTTGAACTCGAGTTCAACTGCTGCTCTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175362.2-1559s21c1
Sequence:CCGGAGAACGATGAGATGCGTATTGCTCGAGCAATACGCATCTCATCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1629s1c1
Sequence:CCGGGCCAGGAAGCTGATGATTCTTCTCGAGAAGAATCATCAGCTTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175362.1-3745s1c1
Sequence:CCGGCCTAGCAACAAAGTTACCAGACTCGAGTCTGGTAACTTTGTTGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-814s1c1
Sequence:CCGGCGACAACTACAACTTAGCCATCTCGAGATGGCTAAGTTGTAGTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-2467s1c1
Sequence:CCGGCCTCATCACTCTGCATTACAACTCGAGTTGTAATGCAGAGTGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1303s1c1
Sequence:CCGGGCACCGCATGAACACAGTTATCTCGAGATAACTGTGTTCATGCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-1667s1c1
Sequence:CCGGCCCGAAGACAGCAAGTACTTTCTCGAGAAAGTACTTGCTGTCTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-3243s1c1
Sequence:CCGGGCAAGTCAGATATTGTCACAACTCGAGTTGTGACAATATCTGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175362.1-2025s1c1
Sequence:CCGGCCTTAGACCTTGACGATGAAACTCGAGTTTCATCGTCAAGGTCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032415
VALIDATED
CARD11 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-494s21c1
Sequence:CCGGGCACATGCTCAGCCGCTATATCTCGAGATATAGCGGCTGAGCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-1578s21c1
Sequence:CCGGCAGTACTCGCAGTGCTTAATCCTCGAGGATTAAGCACTGCGAGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-541s21c1
Sequence:CCGGTGCGTCAGTGTAAGGTCATTGCTCGAGCAATGACCTTACACTGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-4077s1c1
Sequence:CCGGCCAGAGCAGCAGTTGAATGTACTCGAGTACATTCAACTGCTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-529s1c1
Sequence:CCGGCGGCTGTTGGACATTCTACATCTCGAGATGTAGAATGTCCAACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-1260s1c1
Sequence:CCGGGCTGGTCAACAGGATCTACAACTCGAGTTGTAGATCCTGTTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032415.2-1851s1c1
Sequence:CCGGCCTGAAGCGAACATCAGATTTCTCGAGAAATCTGATGTTCGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032415.2-3024s1c1
Sequence:CCGGCGAGAACAAGTATAAGCGGATCTCGAGATCCGCTTATACTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032415
VALIDATED
CARD11 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-494s21c1
Sequence:CCGGGCACATGCTCAGCCGCTATATCTCGAGATATAGCGGCTGAGCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-1578s21c1
Sequence:CCGGCAGTACTCGCAGTGCTTAATCCTCGAGGATTAAGCACTGCGAGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-541s21c1
Sequence:CCGGTGCGTCAGTGTAAGGTCATTGCTCGAGCAATGACCTTACACTGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-4077s1c1
Sequence:CCGGCCAGAGCAGCAGTTGAATGTACTCGAGTACATTCAACTGCTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-529s1c1
Sequence:CCGGCGGCTGTTGGACATTCTACATCTCGAGATGTAGAATGTCCAACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-1260s1c1
Sequence:CCGGGCTGGTCAACAGGATCTACAACTCGAGTTGTAGATCCTGTTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032415.2-1851s1c1
Sequence:CCGGCCTGAAGCGAACATCAGATTTCTCGAGAAATCTGATGTTCGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032415.2-3024s1c1
Sequence:CCGGCGAGAACAAGTATAAGCGGATCTCGAGATCCGCTTATACTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032415
VALIDATED
CARD11 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-494s21c1
Sequence:CCGGGCACATGCTCAGCCGCTATATCTCGAGATATAGCGGCTGAGCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-1578s21c1
Sequence:CCGGCAGTACTCGCAGTGCTTAATCCTCGAGGATTAAGCACTGCGAGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032415.3-541s21c1
Sequence:CCGGTGCGTCAGTGTAAGGTCATTGCTCGAGCAATGACCTTACACTGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-4077s1c1
Sequence:CCGGCCAGAGCAGCAGTTGAATGTACTCGAGTACATTCAACTGCTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-529s1c1
Sequence:CCGGCGGCTGTTGGACATTCTACATCTCGAGATGTAGAATGTCCAACAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_032415.2-1260s1c1
Sequence:CCGGGCTGGTCAACAGGATCTACAACTCGAGTTGTAGATCCTGTTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032415.2-1851s1c1
Sequence:CCGGCCTGAAGCGAACATCAGATTTCTCGAGAAATCTGATGTTCGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032415.2-3024s1c1
Sequence:CCGGCGAGAACAAGTATAAGCGGATCTCGAGATCCGCTTATACTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)