EMAIL THIS PAGE TO A FRIEND

CARD16

caspase recruitment domain family, member 16

67 Gene Product Result for
Synonyms: COP COP1 PSEUDO-ICE
Species: Human CARD16(114769)
UniProtKB ID: Q5EG05, Q96RJ9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052889 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219981 MISSION® esiRNA esiRNA targeting human CARD16 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017534 Rosetta Predictions human pricing
NM_052889 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226819 predicted 315
2 SASI_Hs01_00226820 predicted 380
3 SASI_Hs01_00226821 predicted 323
4 SASI_Hs01_00226822 predicted 293
5 SASI_Hs01_00226823 predicted 438
6 SASI_Hs01_00226824 predicted 407
7 SASI_Hs01_00226825 predicted 369
8 SASI_Hs01_00226826 predicted 399
9 SASI_Hs02_00306794 predicted 413
10 SASI_Hs02_00306795 predicted 416
11 SASI_Hs01_00226827 predicted 355
12 SASI_Hs01_00226828 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182252 predicted 298
2 SASI_Hs01_00182253 predicted 307
3 SASI_Hs01_00182254 predicted 506
4 SASI_Hs01_00182255 predicted 478
5 SASI_Hs01_00182256 predicted 328
6 SASI_Hs01_00182257 predicted 429
7 SASI_Hs01_00182258 predicted 303
8 SASI_Hs01_00182259 predicted 290
9 SASI_Hs01_00182260 predicted 467
10 SASI_Hs01_00182261 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052889
CARD16 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052889.2-291s21c1
Sequence:CCGGACTCTCAGCAGGTCCGATACCCTCGAGGGTATCGGACCTGCTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-631s21c1
Sequence:CCGGAGAATCCCAGGTTTAGGTAAACTCGAGTTTACCTAAACCTGGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-664s21c1
Sequence:CCGGGGAACTCATAAATTATCATAGCTCGAGCTATGATAATTTATGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-330s21c1
Sequence:CCGGACAAGACTCCCAATTACTATTCTCGAGAATAGTAATTGGGAGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052889.2-313s21c1
Sequence:CCGGGGAAATTAGCTTAGTACACAACTCGAGTTGTGTACTAAGCTAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052889.2-605s1c1
Sequence:CCGGCCTTGCATAAAGGATCTCTATCTCGAGATAGAGATCCTTTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-82s1c1
Sequence:CCGGGAAGGTACAATAAATGGCTTACTCGAGTAAGCCATTTATTGTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-74s1c1
Sequence:CCGGCCATGGGTGAAGGTACAATAACTCGAGTTATTGTACCTTCACCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-193s1c1
Sequence:CCGGGCTTTGATTGACTCCGTTATTCTCGAGAATAACGGAGTCAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-299s1c1
Sequence:CCGGCAGGTCCGATACCTGGAAATTCTCGAGAATTTCCAGGTATCGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052889
CARD16 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052889.2-291s21c1
Sequence:CCGGACTCTCAGCAGGTCCGATACCCTCGAGGGTATCGGACCTGCTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-631s21c1
Sequence:CCGGAGAATCCCAGGTTTAGGTAAACTCGAGTTTACCTAAACCTGGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-664s21c1
Sequence:CCGGGGAACTCATAAATTATCATAGCTCGAGCTATGATAATTTATGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-330s21c1
Sequence:CCGGACAAGACTCCCAATTACTATTCTCGAGAATAGTAATTGGGAGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052889.2-313s21c1
Sequence:CCGGGGAAATTAGCTTAGTACACAACTCGAGTTGTGTACTAAGCTAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052889.2-605s1c1
Sequence:CCGGCCTTGCATAAAGGATCTCTATCTCGAGATAGAGATCCTTTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-82s1c1
Sequence:CCGGGAAGGTACAATAAATGGCTTACTCGAGTAAGCCATTTATTGTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-74s1c1
Sequence:CCGGCCATGGGTGAAGGTACAATAACTCGAGTTATTGTACCTTCACCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-193s1c1
Sequence:CCGGGCTTTGATTGACTCCGTTATTCTCGAGAATAACGGAGTCAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-299s1c1
Sequence:CCGGCAGGTCCGATACCTGGAAATTCTCGAGAATTTCCAGGTATCGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052889
CARD16 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052889.2-291s21c1
Sequence:CCGGACTCTCAGCAGGTCCGATACCCTCGAGGGTATCGGACCTGCTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-631s21c1
Sequence:CCGGAGAATCCCAGGTTTAGGTAAACTCGAGTTTACCTAAACCTGGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-664s21c1
Sequence:CCGGGGAACTCATAAATTATCATAGCTCGAGCTATGATAATTTATGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052889.2-330s21c1
Sequence:CCGGACAAGACTCCCAATTACTATTCTCGAGAATAGTAATTGGGAGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052889.2-313s21c1
Sequence:CCGGGGAAATTAGCTTAGTACACAACTCGAGTTGTGTACTAAGCTAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052889.2-605s1c1
Sequence:CCGGCCTTGCATAAAGGATCTCTATCTCGAGATAGAGATCCTTTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-82s1c1
Sequence:CCGGGAAGGTACAATAAATGGCTTACTCGAGTAAGCCATTTATTGTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-74s1c1
Sequence:CCGGCCATGGGTGAAGGTACAATAACTCGAGTTATTGTACCTTCACCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-193s1c1
Sequence:CCGGGCTTTGATTGACTCCGTTATTCTCGAGAATAACGGAGTCAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052889.2-299s1c1
Sequence:CCGGCAGGTCCGATACCTGGAAATTCTCGAGAATTTCCAGGTATCGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks