EMAIL THIS PAGE TO A FRIEND

CARD17

caspase recruitment domain family, member 17

Synonyms: INCA
Species: Human CARD17(440068), naked mole-rat Card17(101700084)
UniProtKB ID: Q5XLA6
Gene ID:
naked mole-rat(101700084) caspase recruitment domain family, member 17
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007232 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007232 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057647 predicted 210
2 SASI_Hs01_00057648 predicted 212
3 SASI_Hs01_00057649 predicted 209
4 SASI_Hs01_00057650 predicted 303
5 SASI_Hs01_00057652 predicted 299
6 SASI_Hs01_00057653 predicted 118
7 SASI_Hs01_00057654 predicted 127
8 SASI_Hs01_00057655 predicted 276
9 SASI_Hs01_00057656 predicted 399
10 SASI_Hs02_00305253 predicted 403
11 SASI_Hs01_00057651 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007232
CARD17 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-312s1c1
Sequence:CCGGCTTACTACACAAGATTCTCAACTCGAGTTGAGAATCTTGTGTAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-183s1c1
Sequence:CCGGGCTTTGCTTGACTCTGTTATTCTCGAGAATAACAGAGTCAAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-71s1c1
Sequence:CCGGCGAAGGTACAATAAATGGCTTCTCGAGAAGCCATTTATTGTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-307s1c1
Sequence:CCGGATCACCTTACTACACAAGATTCTCGAGAATCTTGTGTAGTAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-290s1c1
Sequence:CCGGAGGTCCAACATCTGGAAATCACTCGAGTGATTTCCAGATGTTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007232
CARD17 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-312s1c1
Sequence:CCGGCTTACTACACAAGATTCTCAACTCGAGTTGAGAATCTTGTGTAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-183s1c1
Sequence:CCGGGCTTTGCTTGACTCTGTTATTCTCGAGAATAACAGAGTCAAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-71s1c1
Sequence:CCGGCGAAGGTACAATAAATGGCTTCTCGAGAAGCCATTTATTGTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-307s1c1
Sequence:CCGGATCACCTTACTACACAAGATTCTCGAGAATCTTGTGTAGTAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-290s1c1
Sequence:CCGGAGGTCCAACATCTGGAAATCACTCGAGTGATTTCCAGATGTTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007232
CARD17 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-312s1c1
Sequence:CCGGCTTACTACACAAGATTCTCAACTCGAGTTGAGAATCTTGTGTAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-183s1c1
Sequence:CCGGGCTTTGCTTGACTCTGTTATTCTCGAGAATAACAGAGTCAAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-71s1c1
Sequence:CCGGCGAAGGTACAATAAATGGCTTCTCGAGAAGCCATTTATTGTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-307s1c1
Sequence:CCGGATCACCTTACTACACAAGATTCTCGAGAATCTTGTGTAGTAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007232.1-290s1c1
Sequence:CCGGAGGTCCAACATCTGGAAATCACTCGAGTGATTTCCAGATGTTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks