EMAIL THIS PAGE TO A FRIEND

CARD18

caspase recruitment domain family, member 18

16 Gene Product Result for
Synonyms: ICEBERG UNQ5804 pseudo-ICE
Species: Human CARD18(59082)
UniProtKB ID: P57730, A2RRF8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021571 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090579 predicted 84
2 SASI_Hs01_00090580 predicted 62
3 SASI_Hs01_00090581 predicted 164
4 SASI_Hs01_00090582 predicted 192
5 SASI_Hs01_00090583 predicted 253
6 SASI_Hs01_00090584 predicted 233
7 SASI_Hs01_00090585 predicted 205
8 SASI_Hs01_00090586 predicted 157
9 SASI_Hs01_00090587 predicted 291
10 SASI_Hs01_00090588 predicted 39
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021571
CARD18 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 18
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021571.2-280s1c1
Sequence:CCGGAGATGGAACTCTGGAGCACTTCTCGAGAAGTGCTCCAGAGTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-240s1c1
Sequence:CCGGCCCTCAACTTGCCTCAAAGATCTCGAGATCTTTGAGGCAAGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-237s1c1
Sequence:CCGGAGACCCTCAACTTGCCTCAAACTCGAGTTTGAGGCAAGTTGAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-163s1c1
Sequence:CCGGCGAGTCTTGATTGACCTTGTTCTCGAGAACAAGGTCAATCAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-70s1c1
Sequence:CCGGGCCTTGCTGGATTGCCTATTACTCGAGTAATAGGCAATCCAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021571.3-56s21c1
Sequence:CCGGAGTGGGTGCAGGCACAATAAACTCGAGTTTATTGTGCCTGCACCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021571.3-427s21c1
Sequence:CCGGTCATTCTCTCATATTACTTTCCTCGAGGAAAGTAATATGAGAGAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021571.3-500s21c1
Sequence:CCGGGAAGGTCATGATGATTGTAATCTCGAGATTACAATCATCATGACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021571
CARD18 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 18
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021571.2-280s1c1
Sequence:CCGGAGATGGAACTCTGGAGCACTTCTCGAGAAGTGCTCCAGAGTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-240s1c1
Sequence:CCGGCCCTCAACTTGCCTCAAAGATCTCGAGATCTTTGAGGCAAGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-237s1c1
Sequence:CCGGAGACCCTCAACTTGCCTCAAACTCGAGTTTGAGGCAAGTTGAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-163s1c1
Sequence:CCGGCGAGTCTTGATTGACCTTGTTCTCGAGAACAAGGTCAATCAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-70s1c1
Sequence:CCGGGCCTTGCTGGATTGCCTATTACTCGAGTAATAGGCAATCCAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021571.3-56s21c1
Sequence:CCGGAGTGGGTGCAGGCACAATAAACTCGAGTTTATTGTGCCTGCACCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021571.3-427s21c1
Sequence:CCGGTCATTCTCTCATATTACTTTCCTCGAGGAAAGTAATATGAGAGAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021571.3-500s21c1
Sequence:CCGGGAAGGTCATGATGATTGTAATCTCGAGATTACAATCATCATGACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021571
CARD18 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 18
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021571.2-280s1c1
Sequence:CCGGAGATGGAACTCTGGAGCACTTCTCGAGAAGTGCTCCAGAGTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-240s1c1
Sequence:CCGGCCCTCAACTTGCCTCAAAGATCTCGAGATCTTTGAGGCAAGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-237s1c1
Sequence:CCGGAGACCCTCAACTTGCCTCAAACTCGAGTTTGAGGCAAGTTGAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-163s1c1
Sequence:CCGGCGAGTCTTGATTGACCTTGTTCTCGAGAACAAGGTCAATCAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021571.2-70s1c1
Sequence:CCGGGCCTTGCTGGATTGCCTATTACTCGAGTAATAGGCAATCCAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021571.3-56s21c1
Sequence:CCGGAGTGGGTGCAGGCACAATAAACTCGAGTTTATTGTGCCTGCACCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021571.3-427s21c1
Sequence:CCGGTCATTCTCTCATATTACTTTCCTCGAGGAAAGTAATATGAGAGAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021571.3-500s21c1
Sequence:CCGGGAAGGTCATGATGATTGTAATCTCGAGATTACAATCATCATGACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)