EMAIL THIS PAGE TO A FRIEND

CARD6

caspase recruitment domain family, member 6

68 Gene Product Result for
Synonyms: CINCIN1
UniProtKB ID: Q9BX69, Q52LR2
Gene ID:
Human(84674) Summary: This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
Mouse(239319) caspase recruitment domain family, member 6
Rat(294770) caspase recruitment domain family, member 6
cow(520291) caspase recruitment domain family, member 6
dog(100688481) caspase recruitment domain family, member 6
Horse(100053107) caspase recruitment domain family, member 6
domestic cat(101095402) caspase recruitment domain family, member 6
naked mole-rat(101722311) caspase recruitment domain family, member 6
domestic guinea pig(100713373) caspase recruitment domain family, member 6
sheep(101103184) caspase recruitment domain family, member 6
Domestic Rabbit(100358687) caspase recruitment domain family, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032587 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_139295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007631 MISSION® esiRNA esiRNA targeting human CARD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032587 Rosetta Predictions human pricing
NM_001106413 Rosetta Predictions rat pricing
XM_226804 Rosetta Predictions rat pricing
XM_139295 Rosetta Predictions mouse pricing
XM_904712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181802 predicted 296
2 SASI_Hs01_00181803 predicted 670
3 SASI_Hs01_00181805 predicted 996
4 SASI_Hs01_00181806 predicted 1083
5 SASI_Hs01_00181807 predicted 2626
6 SASI_Hs01_00181808 predicted 2275
7 SASI_Hs01_00181809 predicted 2964
8 SASI_Hs02_00360117 predicted 2529
9 SASI_Hs01_00181810 predicted 1057
10 SASI_Hs02_00360118 predicted 596
11 SASI_Hs01_00181804 predicted 2617
12 SASI_Hs01_00181811 predicted 2166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218718 predicted 2457
2 SASI_Rn02_00218719 predicted 1764
3 SASI_Rn02_00218720 predicted 2441
4 SASI_Rn02_00218721 predicted 199
5 SASI_Rn02_00218722 predicted 3343
6 SASI_Rn02_00218723 predicted 1033
7 SASI_Rn02_00218724 predicted 2709
8 SASI_Rn02_00218725 predicted 2551
9 SASI_Rn02_00218726 predicted 2305
10 SASI_Rn02_00218727 predicted 3165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194975 predicted 2386
2 SASI_Rn01_00194976 predicted 1978
3 SASI_Rn01_00194977 predicted 2064
4 SASI_Rn01_00194978 predicted 2375
5 SASI_Rn01_00194979 predicted 2791
6 SASI_Rn01_00194980 predicted 2639
7 SASI_Rn01_00194981 predicted 2477
8 SASI_Rn01_00194982 predicted 2229
9 SASI_Rn01_00194983 predicted 3035
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232262 predicted 602
2 SASI_Mm01_00232263 predicted 2261
3 SASI_Mm01_00232264 predicted 3515
4 SASI_Mm01_00232265 predicted 1622
5 SASI_Mm01_00232266 predicted 1013
6 SASI_Mm01_00232267 predicted 1924
7 SASI_Mm01_00232269 predicted 2808
8 SASI_Mm01_00232270 predicted 2452
9 SASI_Mm02_00424854 predicted 3058
10 SASI_Mm02_00424855 predicted 1116
11 SASI_Mm01_00232268 predicted 427
12 SASI_Mm01_00232271 predicted 3626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431163 predicted 601
2 SASI_Mm02_00431164 predicted 2266
3 SASI_Mm02_00431165 predicted 3519
4 SASI_Mm02_00431166 predicted 1618
5 SASI_Mm02_00431167 predicted 1022
6 SASI_Mm02_00431168 predicted 1918
7 SASI_Mm02_00431169 predicted 2809
8 SASI_Mm02_00431170 predicted 2448
9 SASI_Mm02_00431171 predicted 3057
10 SASI_Mm02_00431172 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163138
CARD6 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000453118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-3505s21c1
Sequence:CCGGCCGAGACCCACTCAACCTAAACTCGAGTTTAGGTTGAGTGGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-137s21c1
Sequence:CCGGACTCTATCTTGGACACGTTAACTCGAGTTAACGTGTCCAAGATAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-2725s21c1
Sequence:CCGGGCCAGTCAAGAACGGATAATGCTCGAGCATTATCCGTTCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163138.1-3613s21c1
Sequence:CCGGGTGATCTTTGCTTAAGCTATTCTCGAGAATAGCTTAAGCAAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163138
CARD6 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000453118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-3505s21c1
Sequence:CCGGCCGAGACCCACTCAACCTAAACTCGAGTTTAGGTTGAGTGGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-137s21c1
Sequence:CCGGACTCTATCTTGGACACGTTAACTCGAGTTAACGTGTCCAAGATAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-2725s21c1
Sequence:CCGGGCCAGTCAAGAACGGATAATGCTCGAGCATTATCCGTTCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163138.1-3613s21c1
Sequence:CCGGGTGATCTTTGCTTAAGCTATTCTCGAGAATAGCTTAAGCAAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163138
CARD6 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000453118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-3505s21c1
Sequence:CCGGCCGAGACCCACTCAACCTAAACTCGAGTTTAGGTTGAGTGGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-137s21c1
Sequence:CCGGACTCTATCTTGGACACGTTAACTCGAGTTAACGTGTCCAAGATAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163138.1-2725s21c1
Sequence:CCGGGCCAGTCAAGAACGGATAATGCTCGAGCATTATCCGTTCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163138.1-3613s21c1
Sequence:CCGGGTGATCTTTGCTTAAGCTATTCTCGAGAATAGCTTAAGCAAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032587
CARD6 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-629s21c1
Sequence:CCGGGTGAAGTTCCAGCAACTATTACTCGAGTAATAGTTGCTGGAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-2729s21c1
Sequence:CCGGTGATAAGAACATCCCATATTGCTCGAGCAATATGGGATGTTCTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-1799s21c1
Sequence:CCGGCCATTGAAAGATGCTACTTTGCTCGAGCAAAGTAGCATCTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-2406s1c1
Sequence:CCGGCCAGAATTGGAGGTAACTTTACTCGAGTAAAGTTACCTCCAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-2696s1c1
Sequence:CCGGCCACAAATGATGGGAACTCTTCTCGAGAAGAGTTCCCATCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032587.2-3356s1c1
Sequence:CCGGGCCATTCCTATCATATAGTAACTCGAGTTACTATATGATAGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-1631s1c1
Sequence:CCGGGCCCAGTTGAAATTACACAAACTCGAGTTTGTGTAATTTCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032587
CARD6 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-629s21c1
Sequence:CCGGGTGAAGTTCCAGCAACTATTACTCGAGTAATAGTTGCTGGAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-2729s21c1
Sequence:CCGGTGATAAGAACATCCCATATTGCTCGAGCAATATGGGATGTTCTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-1799s21c1
Sequence:CCGGCCATTGAAAGATGCTACTTTGCTCGAGCAAAGTAGCATCTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-2406s1c1
Sequence:CCGGCCAGAATTGGAGGTAACTTTACTCGAGTAAAGTTACCTCCAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-2696s1c1
Sequence:CCGGCCACAAATGATGGGAACTCTTCTCGAGAAGAGTTCCCATCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032587.2-3356s1c1
Sequence:CCGGGCCATTCCTATCATATAGTAACTCGAGTTACTATATGATAGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-1631s1c1
Sequence:CCGGGCCCAGTTGAAATTACACAAACTCGAGTTTGTGTAATTTCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032587
CARD6 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-629s21c1
Sequence:CCGGGTGAAGTTCCAGCAACTATTACTCGAGTAATAGTTGCTGGAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-2729s21c1
Sequence:CCGGTGATAAGAACATCCCATATTGCTCGAGCAATATGGGATGTTCTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032587.3-1799s21c1
Sequence:CCGGCCATTGAAAGATGCTACTTTGCTCGAGCAAAGTAGCATCTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-2406s1c1
Sequence:CCGGCCAGAATTGGAGGTAACTTTACTCGAGTAAAGTTACCTCCAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-2696s1c1
Sequence:CCGGCCACAAATGATGGGAACTCTTCTCGAGAAGAGTTCCCATCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032587.2-3356s1c1
Sequence:CCGGGCCATTCCTATCATATAGTAACTCGAGTTACTATATGATAGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032587.2-1631s1c1
Sequence:CCGGGCCCAGTTGAAATTACACAAACTCGAGTTTGTGTAATTTCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139295
CARD6 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000092173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_139295.2-4173s1c1
Sequence:CCGGGCCAAATCATACGTGCAAGATCTCGAGATCTTGCACGTATGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-606s1c1
Sequence:CCGGCCCAGCAAGTATCACCTTCTTCTCGAGAAGAAGGTGATACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-2286s1c1
Sequence:CCGGCCACTTTAGATCACAGCAGAACTCGAGTTCTGCTGTGATCTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-651s1c1
Sequence:CCGGGCCAGATGATTCGCTGTACTTCTCGAGAAGTACAGCGAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139295
CARD6 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000092173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_139295.2-4173s1c1
Sequence:CCGGGCCAAATCATACGTGCAAGATCTCGAGATCTTGCACGTATGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-606s1c1
Sequence:CCGGCCCAGCAAGTATCACCTTCTTCTCGAGAAGAAGGTGATACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-2286s1c1
Sequence:CCGGCCACTTTAGATCACAGCAGAACTCGAGTTCTGCTGTGATCTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-651s1c1
Sequence:CCGGGCCAGATGATTCGCTGTACTTCTCGAGAAGTACAGCGAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139295
CARD6 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000092173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_139295.2-4173s1c1
Sequence:CCGGGCCAAATCATACGTGCAAGATCTCGAGATCTTGCACGTATGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-606s1c1
Sequence:CCGGCCCAGCAAGTATCACCTTCTTCTCGAGAAGAAGGTGATACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-2286s1c1
Sequence:CCGGCCACTTTAGATCACAGCAGAACTCGAGTTCTGCTGTGATCTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139295.2-651s1c1
Sequence:CCGGGCCAGATGATTCGCTGTACTTCTCGAGAAGTACAGCGAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks