EMAIL THIS PAGE TO A FRIEND

CARD8

caspase recruitment domain family, member 8

206 Gene Product Result for
Synonyms: CARDINAL DACAR DAKAR NDPP NDPP1 TUCAN
Gene ID:
Human(22900) Summary: The protein encoded by this gene belongs to the caspase recruitment domain (CARD)-containing family of proteins, which are involved in pathways leading to activation of caspases or nuclear factor kappa-B (NFKB). This protein may be a component of the inflammasome, a protein complex that plays a role in the activation of proinflammatory caspases. It is thought that this protein acts as an adaptor molecule that negatively regulates NFKB activation, CASP1-dependent IL1B secretion, and apoptosis. Polymorphisms in this gene may be associated with a susceptibility to rheumatoid arthritis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
chicken(416998) caspase recruitment domain family, member 8
domestic cat(101093817) caspase recruitment domain family, member 8
dog(491519) caspase recruitment domain family, member 8
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014959 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070091 MISSION® esiRNA esiRNA human CARD8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014959 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346640 predicted 385
2 SASI_Hs01_00034180 predicted 493
3 SASI_Hs01_00034181 predicted 327
4 SASI_Hs02_00346641 predicted 389
5 SASI_Hs02_00346642 predicted 779
6 SASI_Hs01_00034183 predicted 1105
7 SASI_Hs01_00034185 predicted 1011
8 SASI_Hs01_00034186 predicted 1151
9 SASI_Hs01_00034188 predicted 1563
10 SASI_Hs02_00346643 predicted 1583
11 SASI_Hs01_00034179 predicted 1236
12 SASI_Hs01_00034182 predicted 1431
13 SASI_Hs01_00034184 predicted 1263
14 SASI_Hs01_00034187 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014959
VALIDATED
CARD8 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014959.1-2472s1c1
Sequence:CCGGGCACACATATTTCCATCCTTTCTCGAGAAAGGATGGAAATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014959.1-1016s1c1
Sequence:CCGGGCCTTGCTAACAAAGGCGATACTCGAGTATCGCCTTTGTTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-851s1c1
Sequence:CCGGCCTTTCTATGCTGTCCTGGAACTCGAGTTCCAGGACAGCATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-525s1c1
Sequence:CCGGGCACAAACAGATACAGCGTTTCTCGAGAAACGCTGTATCTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-1584s1c1
Sequence:CCGGCCTATCTTAGACAGCAGAATTCTCGAGAATTCTGCTGTCTAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-378s21c1
Sequence:CCGGGGACATTCCCAGGAGACATTTCTCGAGAAATGTCTCCTGGGAATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-503s21c1
Sequence:CCGGGATGTTGAGTTGATTGATAAGCTCGAGCTTATCAATCAACTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1098s21c1
Sequence:CCGGTGAACTTTGGTTCCAGTTATACTCGAGTATAACTGGAACCAAAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014959.2-1805s21c1
Sequence:CCGGTCTGAAGAAGGTAGTAATATTCTCGAGAATATTACTACCTTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-419s21c1
Sequence:CCGGGTTTCCTCTTATGCTTCTAAACTCGAGTTTAGAAGCATAAGAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1539s21c1
Sequence:CCGGACGTGCTCTTCAGAAGCATTACTCGAGTAATGCTTCTGAAGAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1266s21c1
Sequence:CCGGGGACTTTGGTGTGGGATACTGCTCGAGCAGTATCCCACACCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014959.2-1752s21c1
Sequence:CCGGGTAACCTGGCATGTACCTATTCTCGAGAATAGGTACATGCCAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014959
VALIDATED
CARD8 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014959.1-2472s1c1
Sequence:CCGGGCACACATATTTCCATCCTTTCTCGAGAAAGGATGGAAATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014959.1-1016s1c1
Sequence:CCGGGCCTTGCTAACAAAGGCGATACTCGAGTATCGCCTTTGTTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-851s1c1
Sequence:CCGGCCTTTCTATGCTGTCCTGGAACTCGAGTTCCAGGACAGCATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-525s1c1
Sequence:CCGGGCACAAACAGATACAGCGTTTCTCGAGAAACGCTGTATCTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-1584s1c1
Sequence:CCGGCCTATCTTAGACAGCAGAATTCTCGAGAATTCTGCTGTCTAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-378s21c1
Sequence:CCGGGGACATTCCCAGGAGACATTTCTCGAGAAATGTCTCCTGGGAATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-503s21c1
Sequence:CCGGGATGTTGAGTTGATTGATAAGCTCGAGCTTATCAATCAACTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1098s21c1
Sequence:CCGGTGAACTTTGGTTCCAGTTATACTCGAGTATAACTGGAACCAAAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014959.2-1805s21c1
Sequence:CCGGTCTGAAGAAGGTAGTAATATTCTCGAGAATATTACTACCTTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-419s21c1
Sequence:CCGGGTTTCCTCTTATGCTTCTAAACTCGAGTTTAGAAGCATAAGAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1539s21c1
Sequence:CCGGACGTGCTCTTCAGAAGCATTACTCGAGTAATGCTTCTGAAGAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1266s21c1
Sequence:CCGGGGACTTTGGTGTGGGATACTGCTCGAGCAGTATCCCACACCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014959.2-1752s21c1
Sequence:CCGGGTAACCTGGCATGTACCTATTCTCGAGAATAGGTACATGCCAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014959
VALIDATED
CARD8 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014959.1-2472s1c1
Sequence:CCGGGCACACATATTTCCATCCTTTCTCGAGAAAGGATGGAAATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014959.1-1016s1c1
Sequence:CCGGGCCTTGCTAACAAAGGCGATACTCGAGTATCGCCTTTGTTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-851s1c1
Sequence:CCGGCCTTTCTATGCTGTCCTGGAACTCGAGTTCCAGGACAGCATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-525s1c1
Sequence:CCGGGCACAAACAGATACAGCGTTTCTCGAGAAACGCTGTATCTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014959.1-1584s1c1
Sequence:CCGGCCTATCTTAGACAGCAGAATTCTCGAGAATTCTGCTGTCTAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-378s21c1
Sequence:CCGGGGACATTCCCAGGAGACATTTCTCGAGAAATGTCTCCTGGGAATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-503s21c1
Sequence:CCGGGATGTTGAGTTGATTGATAAGCTCGAGCTTATCAATCAACTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1098s21c1
Sequence:CCGGTGAACTTTGGTTCCAGTTATACTCGAGTATAACTGGAACCAAAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014959.2-1805s21c1
Sequence:CCGGTCTGAAGAAGGTAGTAATATTCTCGAGAATATTACTACCTTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-419s21c1
Sequence:CCGGGTTTCCTCTTATGCTTCTAAACTCGAGTTTAGAAGCATAAGAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1539s21c1
Sequence:CCGGACGTGCTCTTCAGAAGCATTACTCGAGTAATGCTTCTGAAGAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014959.2-1266s21c1
Sequence:CCGGGGACTTTGGTGTGGGATACTGCTCGAGCAGTATCCCACACCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014959.2-1752s21c1
Sequence:CCGGGTAACCTGGCATGTACCTATTCTCGAGAATAGGTACATGCCAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks