EMAIL THIS PAGE TO A FRIEND

CARD9

caspase recruitment domain family, member 9

80 Gene Product Result for
Synonyms: CANDF2 hCARD9
UniProtKB ID: Q9H257, Q5SXM5, Q5SXM6, Q9H854
Gene ID:
Human(64170) Summary: The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
Mouse(332579) caspase recruitment domain family, member 9
Rat(64171) caspase recruitment domain family, member 9
Zebrafish(796425) caspase recruitment domain family, member 9
cow(768054) caspase recruitment domain family, member 9
Horse(100068666) caspase recruitment domain family, member 9
domestic cat(101093152) caspase recruitment domain family, member 9
dog(607492) caspase recruitment domain family, member 9
chicken(427756) caspase recruitment domain family, member 9
sheep(101116560) caspase recruitment domain family, member 9
domestic guinea pig(100713392) caspase recruitment domain family, member 9
naked mole-rat(101726760) caspase recruitment domain family, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A5845 N-Acetyl-Leu-Glu-His-Asp-7-amido-4-trifluoromethylcoumarin ≥95% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139641 MISSION® esiRNA esiRNA human CARD9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052813 Rosetta Predictions human pricing
NM_022303 Rosetta Predictions rat pricing
NM_001037747 Rosetta Predictions mouse pricing
XM_285326 Rosetta Predictions mouse pricing
XM_897897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054743 predicted 1183
2 SASI_Hs01_00054744 predicted 745
3 SASI_Hs02_00361490 predicted 301
4 SASI_Hs01_00054745 predicted 843
5 SASI_Hs02_00361491 predicted 406
6 SASI_Hs01_00054746 predicted 724
7 SASI_Hs01_00054747 predicted 1312
8 SASI_Hs01_00054748 predicted 365
9 SASI_Hs01_00054749 predicted 810
10 SASI_Hs01_00054750 predicted 1190
11 SASI_Hs01_00054742 predicted 1850
12 SASI_Hs01_00054751 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052879 predicted 1223
2 SASI_Rn01_00052880 predicted 407
3 SASI_Rn01_00052881 predicted 1585
4 SASI_Rn02_00263128 predicted 1210
5 SASI_Rn02_00263129 predicted 202
6 SASI_Rn01_00052883 predicted 1201
7 SASI_Rn02_00263130 predicted 502
8 SASI_Rn01_00052884 predicted 757
9 SASI_Rn01_00052885 predicted 924
10 SASI_Rn01_00052886 predicted 776
11 SASI_Rn01_00052878 predicted 1147
12 SASI_Rn01_00052882 predicted 361
13 SASI_Rn01_00052887 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289399 predicted 1114
2 SASI_Mm02_00289400 predicted 480
3 SASI_Mm02_00289401 predicted 854
4 SASI_Mm02_00289402 predicted 525
5 SASI_Mm02_00289403 predicted 1088
6 SASI_Mm02_00289404 predicted 250
7 SASI_Mm02_00289405 predicted 386
8 SASI_Mm02_00289406 predicted 823
9 SASI_Mm02_00289407 predicted 1073
10 SASI_Mm02_00289408 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_285326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251820 predicted 1105
2 SASI_Mm01_00251821 predicted 866
3 SASI_Mm01_00251822 predicted 560
4 SASI_Mm01_00251823 predicted 1092
5 SASI_Mm01_00251824 predicted 256
6 SASI_Mm01_00251825 predicted 390
7 SASI_Mm01_00251826 predicted 827
8 SASI_Mm01_00251827 predicted 1076
9 SASI_Mm01_00251828 predicted 816
10 SASI_Mm01_00251829 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228209 predicted 413
2 SASI_Mm01_00228210 predicted 264
3 SASI_Mm01_00228211 predicted 401
4 SASI_Mm01_00228212 predicted 403
5 SASI_Mm01_00228213 predicted 399
6 SASI_Mm01_00228214 predicted 413
7 SASI_Mm01_00228215 predicted 290
8 SASI_Mm01_00228216 predicted 346
9 SASI_Mm01_00228217 predicted 258
10 SASI_Mm01_00228218 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052813
CARD9 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-1126s21c1
Sequence:CCGGGGAGAAGGAGATGTTCGAGCTCTCGAGAGCTCGAACATCTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-510s21c1
Sequence:CCGGTGACTCAGCTGCTGATGACTGCTCGAGCAGTCATCAGCAGCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-247s21c1
Sequence:CCGGCTCACGCATCACACCTTACCTCTCGAGAGGTAAGGTGTGATGCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-802s21c1
Sequence:CCGGGCTCAAGCACAGCCTCATGAACTCGAGTTCATGAGGCTGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052813.2-1920s1c1
Sequence:CCGGCGTTTGTTAAGCGGCACTCATCTCGAGATGAGTGCCGCTTAACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-1659s1c1
Sequence:CCGGCGCCCTCAGGAAGATGCAGAACTCGAGTTCTGCATCTTCCTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-555s1c1
Sequence:CCGGCTCCAAAGATGACTTCATCAACTCGAGTTGATGAAGTCATCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-300s1c1
Sequence:CCGGCCTGGTCATCCGCAAACGGAACTCGAGTTCCGTTTGCGGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-1149s1c1
Sequence:CCGGCAAGATGTACAAGGACCGCATCTCGAGATGCGGTCCTTGTACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052813
CARD9 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-1126s21c1
Sequence:CCGGGGAGAAGGAGATGTTCGAGCTCTCGAGAGCTCGAACATCTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-510s21c1
Sequence:CCGGTGACTCAGCTGCTGATGACTGCTCGAGCAGTCATCAGCAGCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-247s21c1
Sequence:CCGGCTCACGCATCACACCTTACCTCTCGAGAGGTAAGGTGTGATGCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-802s21c1
Sequence:CCGGGCTCAAGCACAGCCTCATGAACTCGAGTTCATGAGGCTGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052813.2-1920s1c1
Sequence:CCGGCGTTTGTTAAGCGGCACTCATCTCGAGATGAGTGCCGCTTAACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-1659s1c1
Sequence:CCGGCGCCCTCAGGAAGATGCAGAACTCGAGTTCTGCATCTTCCTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-555s1c1
Sequence:CCGGCTCCAAAGATGACTTCATCAACTCGAGTTGATGAAGTCATCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-300s1c1
Sequence:CCGGCCTGGTCATCCGCAAACGGAACTCGAGTTCCGTTTGCGGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-1149s1c1
Sequence:CCGGCAAGATGTACAAGGACCGCATCTCGAGATGCGGTCCTTGTACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052813
CARD9 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-1126s21c1
Sequence:CCGGGGAGAAGGAGATGTTCGAGCTCTCGAGAGCTCGAACATCTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-510s21c1
Sequence:CCGGTGACTCAGCTGCTGATGACTGCTCGAGCAGTCATCAGCAGCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-247s21c1
Sequence:CCGGCTCACGCATCACACCTTACCTCTCGAGAGGTAAGGTGTGATGCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052813.4-802s21c1
Sequence:CCGGGCTCAAGCACAGCCTCATGAACTCGAGTTCATGAGGCTGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052813.2-1920s1c1
Sequence:CCGGCGTTTGTTAAGCGGCACTCATCTCGAGATGAGTGCCGCTTAACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-1659s1c1
Sequence:CCGGCGCCCTCAGGAAGATGCAGAACTCGAGTTCTGCATCTTCCTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-555s1c1
Sequence:CCGGCTCCAAAGATGACTTCATCAACTCGAGTTGATGAAGTCATCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-300s1c1
Sequence:CCGGCCTGGTCATCCGCAAACGGAACTCGAGTTCCGTTTGCGGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052813.2-1149s1c1
Sequence:CCGGCAAGATGTACAAGGACCGCATCTCGAGATGCGGTCCTTGTACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037747
CARD9 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-1115s21c1
Sequence:CCGGCCCAAAGCTTTCAGGACAAAGCTCGAGCTTTGTCCTGAAAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-252s21c1
Sequence:CCGGGCTCTACTACCCTCAGTTATACTCGAGTATAACTGAGGGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-302s21c1
Sequence:CCGGGCGTCTTCTCCATGATCATTGCTCGAGCAATGATCATGGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-56s21c1
Sequence:CCGGTGAAGCTCATCTCTGTCATTGCTCGAGCAATGACAGAGATGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-1198s21c1
Sequence:CCGGTTCCAGACGGAGAGCCGATTACTCGAGTAATCGGCTCTCCGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037747
CARD9 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-1115s21c1
Sequence:CCGGCCCAAAGCTTTCAGGACAAAGCTCGAGCTTTGTCCTGAAAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-252s21c1
Sequence:CCGGGCTCTACTACCCTCAGTTATACTCGAGTATAACTGAGGGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-302s21c1
Sequence:CCGGGCGTCTTCTCCATGATCATTGCTCGAGCAATGATCATGGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-56s21c1
Sequence:CCGGTGAAGCTCATCTCTGTCATTGCTCGAGCAATGACAGAGATGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-1198s21c1
Sequence:CCGGTTCCAGACGGAGAGCCGATTACTCGAGTAATCGGCTCTCCGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037747
CARD9 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-1115s21c1
Sequence:CCGGCCCAAAGCTTTCAGGACAAAGCTCGAGCTTTGTCCTGAAAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-252s21c1
Sequence:CCGGGCTCTACTACCCTCAGTTATACTCGAGTATAACTGAGGGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-302s21c1
Sequence:CCGGGCGTCTTCTCCATGATCATTGCTCGAGCAATGATCATGGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-56s21c1
Sequence:CCGGTGAAGCTCATCTCTGTCATTGCTCGAGCAATGACAGAGATGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037747.1-1198s21c1
Sequence:CCGGTTCCAGACGGAGAGCCGATTACTCGAGTAATCGGCTCTCCGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks