EMAIL THIS PAGE TO A FRIEND

CARF

calcium responsive transcription factor

101 Gene Product Result for
Synonyms: ALS2CR8 NYD-SP24
Gene ID:
Mouse(241066) calcium response factor
Rat(301446) calcium responsive transcription factor
domestic guinea pig(100724120) calcium responsive transcription factor
naked mole-rat(101698991) calcium responsive transcription factor
Zebrafish(555728) calcium responsive transcription factor
cow(509072) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024744 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139661 MISSION® esiRNA esiRNA human ALS2CR8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104586 Rosetta Predictions human pricing
NM_024744 Rosetta Predictions human pricing
NM_001106915 Rosetta Predictions rat pricing
NM_139150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323754 predicted 1850
2 SASI_Hs02_00323755 predicted 1728
3 SASI_Hs02_00323756 predicted 1585
4 SASI_Hs02_00323757 predicted 1405
5 SASI_Hs02_00323758 predicted 611
6 SASI_Hs02_00323759 predicted 769
7 SASI_Hs02_00323760 predicted 1214
8 SASI_Hs02_00323761 predicted 533
9 SASI_Hs02_00323762 predicted 1079
10 SASI_Hs02_00323763 predicted 1644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084318 predicted 2607
2 SASI_Hs01_00084321 predicted 2484
3 SASI_Hs01_00084322 predicted 2348
4 SASI_Hs01_00084323 predicted 2163
5 SASI_Hs02_00357226 predicted 1368
6 SASI_Hs01_00084324 predicted 1527
7 SASI_Hs01_00084325 predicted 1974
8 SASI_Hs02_00357227 predicted 1293
9 SASI_Hs01_00084326 predicted 1837
10 SASI_Hs02_00357228 predicted 2401
11 SASI_Hs01_00084319 predicted 1675
12 SASI_Hs01_00084320 predicted 2715
13 SASI_Hs01_00084327 predicted 2913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223656 predicted 1784
2 SASI_Rn02_00223657 predicted 915
3 SASI_Rn02_00223658 predicted 1613
4 SASI_Rn02_00223659 predicted 2344
5 SASI_Rn02_00223660 predicted 1951
6 SASI_Rn02_00223661 predicted 1800
7 SASI_Rn02_00223662 predicted 2484
8 SASI_Rn02_00223663 predicted 1645
9 SASI_Rn02_00223664 predicted 1546
10 SASI_Rn02_00223665 predicted 1731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111253 predicted 606
2 SASI_Mm01_00111254 predicted 1942
3 SASI_Mm02_00339906 predicted 758
4 SASI_Mm01_00111255 predicted 665
5 SASI_Mm01_00111256 predicted 1378
6 SASI_Mm01_00111258 predicted 1635
7 SASI_Mm01_00111259 predicted 1613
8 SASI_Mm01_00111260 predicted 2085
9 SASI_Mm02_00339907 predicted 1417
10 SASI_Mm02_00339908 predicted 1238
11 SASI_Mm01_00111257 predicted 2162
12 SASI_Mm01_00111261 predicted 205
13 SASI_Mm01_00111262 predicted 2072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024744
VALIDATED
CARF MISSION shRNA Bacterial Glycerol Stock
calcium responsive transcription factor
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1937s1c1
Sequence:CCGGCCCTCACGTTTACATCCTCAACTCGAGTTGAGGATGTAAACGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-2713s1c1
Sequence:CCGGGCAGACTATTCCAATACAGATCTCGAGATCTGTATTGGAATAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2228s1c1
Sequence:CCGGGAGACCATGACAGTTACATTTCTCGAGAAATGTAACTGTCATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2791s1c1
Sequence:CCGGCCAAGTTAAACAAGAACCCAACTCGAGTTGGGTTCTTGTTTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1138s1c1
Sequence:CCGGGAAACCCAGTAACAGAAACTTCTCGAGAAGTTTCTGTTACTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-952s1c1
Sequence:CCGGGCAGGCTATTCAATATGAACTCTCGAGAGTTCATATTGAATAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2918s1c1
Sequence:CCGGGTCTTAGAAAGGAAGGTGAATCTCGAGATTCACCTTCCTTTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1643s1c1
Sequence:CCGGCCAGCTCGGATTTACATTAAACTCGAGTTTAATGTAAATCCGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1515s1c1
Sequence:CCGGCATTTGTTAATGCAGGGAGTACTCGAGTACTCCCTGCATTAACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-841s1c1
Sequence:CCGGCATCACTACTCGTGAAGCAAACTCGAGTTTGCTTCACGAGTAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024744.14-4729s21c1
Sequence:CCGGGAGACCATTTGTGGGTATATTCTCGAGAATATACCCACAAATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1371s21c1
Sequence:CCGGTGGACAGGTACTTCGTGTAATCTCGAGATTACACGAAGTACCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-2769s21c1
Sequence:CCGGACCAGCTGTGGTATCAGTAAACTCGAGTTTACTGATACCACAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1208s21c1
Sequence:CCGGCACTCATATCACAGAATATACCTCGAGGTATATTCTGTGATATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024744.14-5250s21c1
Sequence:CCGGGTGTTGCACTATAGGTAATATCTCGAGATATTACCTATAGTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-1650s21c1
Sequence:CCGGTATATGGGCCTGCCGTCTTAGCTCGAGCTAAGACGGCAGGCCCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1408s21c1
Sequence:CCGGGGAATGGCACAAGTGATTATACTCGAGTATAATCACTTGTGCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-2489s21c1
Sequence:CCGGGAAATGGAGATACGGTATATACTCGAGTATATACCGTATCTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-2407s21c1
Sequence:CCGGGTACCTGAAAGACATAATTTACTCGAGTAAATTATGTCTTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-1726s21c1
Sequence:CCGGTTAGAAAGTGTCCTAACATTTCTCGAGAAATGTTAGGACACTTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024744
VALIDATED
CARF MISSION shRNA shRNA Plasmid DNA
calcium responsive transcription factor
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1937s1c1
Sequence:CCGGCCCTCACGTTTACATCCTCAACTCGAGTTGAGGATGTAAACGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-2713s1c1
Sequence:CCGGGCAGACTATTCCAATACAGATCTCGAGATCTGTATTGGAATAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2228s1c1
Sequence:CCGGGAGACCATGACAGTTACATTTCTCGAGAAATGTAACTGTCATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2791s1c1
Sequence:CCGGCCAAGTTAAACAAGAACCCAACTCGAGTTGGGTTCTTGTTTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1138s1c1
Sequence:CCGGGAAACCCAGTAACAGAAACTTCTCGAGAAGTTTCTGTTACTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-952s1c1
Sequence:CCGGGCAGGCTATTCAATATGAACTCTCGAGAGTTCATATTGAATAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2918s1c1
Sequence:CCGGGTCTTAGAAAGGAAGGTGAATCTCGAGATTCACCTTCCTTTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1643s1c1
Sequence:CCGGCCAGCTCGGATTTACATTAAACTCGAGTTTAATGTAAATCCGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1515s1c1
Sequence:CCGGCATTTGTTAATGCAGGGAGTACTCGAGTACTCCCTGCATTAACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-841s1c1
Sequence:CCGGCATCACTACTCGTGAAGCAAACTCGAGTTTGCTTCACGAGTAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024744.14-4729s21c1
Sequence:CCGGGAGACCATTTGTGGGTATATTCTCGAGAATATACCCACAAATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1371s21c1
Sequence:CCGGTGGACAGGTACTTCGTGTAATCTCGAGATTACACGAAGTACCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-2769s21c1
Sequence:CCGGACCAGCTGTGGTATCAGTAAACTCGAGTTTACTGATACCACAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1208s21c1
Sequence:CCGGCACTCATATCACAGAATATACCTCGAGGTATATTCTGTGATATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024744.14-5250s21c1
Sequence:CCGGGTGTTGCACTATAGGTAATATCTCGAGATATTACCTATAGTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-1650s21c1
Sequence:CCGGTATATGGGCCTGCCGTCTTAGCTCGAGCTAAGACGGCAGGCCCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1408s21c1
Sequence:CCGGGGAATGGCACAAGTGATTATACTCGAGTATAATCACTTGTGCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-2489s21c1
Sequence:CCGGGAAATGGAGATACGGTATATACTCGAGTATATACCGTATCTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-2407s21c1
Sequence:CCGGGTACCTGAAAGACATAATTTACTCGAGTAAATTATGTCTTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-1726s21c1
Sequence:CCGGTTAGAAAGTGTCCTAACATTTCTCGAGAAATGTTAGGACACTTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024744
VALIDATED
CARF MISSION shRNA Lentiviral Transduction Particles
calcium responsive transcription factor
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1937s1c1
Sequence:CCGGCCCTCACGTTTACATCCTCAACTCGAGTTGAGGATGTAAACGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-2713s1c1
Sequence:CCGGGCAGACTATTCCAATACAGATCTCGAGATCTGTATTGGAATAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2228s1c1
Sequence:CCGGGAGACCATGACAGTTACATTTCTCGAGAAATGTAACTGTCATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2791s1c1
Sequence:CCGGCCAAGTTAAACAAGAACCCAACTCGAGTTGGGTTCTTGTTTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1138s1c1
Sequence:CCGGGAAACCCAGTAACAGAAACTTCTCGAGAAGTTTCTGTTACTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-952s1c1
Sequence:CCGGGCAGGCTATTCAATATGAACTCTCGAGAGTTCATATTGAATAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-2918s1c1
Sequence:CCGGGTCTTAGAAAGGAAGGTGAATCTCGAGATTCACCTTCCTTTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1643s1c1
Sequence:CCGGCCAGCTCGGATTTACATTAAACTCGAGTTTAATGTAAATCCGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024744.12-1515s1c1
Sequence:CCGGCATTTGTTAATGCAGGGAGTACTCGAGTACTCCCTGCATTAACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024744.12-841s1c1
Sequence:CCGGCATCACTACTCGTGAAGCAAACTCGAGTTTGCTTCACGAGTAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024744.14-4729s21c1
Sequence:CCGGGAGACCATTTGTGGGTATATTCTCGAGAATATACCCACAAATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1371s21c1
Sequence:CCGGTGGACAGGTACTTCGTGTAATCTCGAGATTACACGAAGTACCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-2769s21c1
Sequence:CCGGACCAGCTGTGGTATCAGTAAACTCGAGTTTACTGATACCACAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1208s21c1
Sequence:CCGGCACTCATATCACAGAATATACCTCGAGGTATATTCTGTGATATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024744.14-5250s21c1
Sequence:CCGGGTGTTGCACTATAGGTAATATCTCGAGATATTACCTATAGTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-1650s21c1
Sequence:CCGGTATATGGGCCTGCCGTCTTAGCTCGAGCTAAGACGGCAGGCCCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-1408s21c1
Sequence:CCGGGGAATGGCACAAGTGATTATACTCGAGTATAATCACTTGTGCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-2489s21c1
Sequence:CCGGGAAATGGAGATACGGTATATACTCGAGTATATACCGTATCTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024744.14-2407s21c1
Sequence:CCGGGTACCTGAAAGACATAATTTACTCGAGTAAATTATGTCTTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024744.14-1726s21c1
Sequence:CCGGTTAGAAAGTGTCCTAACATTTCTCGAGAAATGTTAGGACACTTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139150
CARF MISSION shRNA Bacterial Glycerol Stock
calcium responsive transcription factor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139150.1-2384s1c1
Sequence:CCGGGCTCCAATATTTGTTGCCAATCTCGAGATTGGCAACAAATATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-1058s1c1
Sequence:CCGGCCAGCCAGGATATACATTAAACTCGAGTTTAATGTATATCCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-224s1c1
Sequence:CCGGGACGATGGTGAGAAGTCAGAACTCGAGTTCTGACTTCTCACCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-533s1c1
Sequence:CCGGGCAGATGAACATAGCCCTCAACTCGAGTTGAGGGCTATGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-1376s1c1
Sequence:CCGGGCGCATAAGATTCAGGAACTACTCGAGTAGTTCCTGAATCTTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-1476s21c1
Sequence:CCGGAGATACCTGAAAGACATAATTCTCGAGAATTATGTCTTTCAGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-2162s21c1
Sequence:CCGGCTGTCTAAGAACCAAGTTAAACTCGAGTTTAACTTGGTTCTTAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-1603s21c1
Sequence:CCGGGCTTCAGTGGACGACAGATAGCTCGAGCTATCTGTCGTCCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139150
CARF MISSION shRNA shRNA Plasmid DNA
calcium responsive transcription factor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139150.1-2384s1c1
Sequence:CCGGGCTCCAATATTTGTTGCCAATCTCGAGATTGGCAACAAATATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-1058s1c1
Sequence:CCGGCCAGCCAGGATATACATTAAACTCGAGTTTAATGTATATCCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-224s1c1
Sequence:CCGGGACGATGGTGAGAAGTCAGAACTCGAGTTCTGACTTCTCACCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-533s1c1
Sequence:CCGGGCAGATGAACATAGCCCTCAACTCGAGTTGAGGGCTATGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-1376s1c1
Sequence:CCGGGCGCATAAGATTCAGGAACTACTCGAGTAGTTCCTGAATCTTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-1476s21c1
Sequence:CCGGAGATACCTGAAAGACATAATTCTCGAGAATTATGTCTTTCAGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-2162s21c1
Sequence:CCGGCTGTCTAAGAACCAAGTTAAACTCGAGTTTAACTTGGTTCTTAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-1603s21c1
Sequence:CCGGGCTTCAGTGGACGACAGATAGCTCGAGCTATCTGTCGTCCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139150
CARF MISSION shRNA Lentiviral Transduction Particles
calcium responsive transcription factor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139150.1-2384s1c1
Sequence:CCGGGCTCCAATATTTGTTGCCAATCTCGAGATTGGCAACAAATATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-1058s1c1
Sequence:CCGGCCAGCCAGGATATACATTAAACTCGAGTTTAATGTATATCCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-224s1c1
Sequence:CCGGGACGATGGTGAGAAGTCAGAACTCGAGTTCTGACTTCTCACCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-533s1c1
Sequence:CCGGGCAGATGAACATAGCCCTCAACTCGAGTTGAGGGCTATGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139150.1-1376s1c1
Sequence:CCGGGCGCATAAGATTCAGGAACTACTCGAGTAGTTCCTGAATCTTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-1476s21c1
Sequence:CCGGAGATACCTGAAAGACATAATTCTCGAGAATTATGTCTTTCAGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-2162s21c1
Sequence:CCGGCTGTCTAAGAACCAAGTTAAACTCGAGTTTAACTTGGTTCTTAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139150.4-1603s21c1
Sequence:CCGGGCTTCAGTGGACGACAGATAGCTCGAGCTATCTGTCGTCCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks