EMAIL THIS PAGE TO A FRIEND

CARHSP1

calcium regulated heat stable protein 1, 24kDa

72 Gene Product Result for
Synonyms: CRHSP-24 CSDC1
UniProtKB ID: Q9Y2V2, B2R4C3, D3DUF5, Q2YDX5, Q9BQ53
Gene ID:
Mouse(52502) calcium regulated heat stable protein 1
Rat(260416) calcium regulated heat stable protein 1
naked mole-rat(101714358) calcium regulated heat stable protein 1, 24kDa
domestic guinea pig(100726153) calcium regulated heat stable protein 1, 24kDa
sheep(101106225) calcium regulated heat stable protein 1, 24kDa
Zebrafish(393534) calcium regulated heat stable protein 1
domestic cat(101088539) calcium regulated heat stable protein 1, 24kDa
cow(506760) calcium regulated heat stable protein 1, 24kDa
chicken(416640) calcium regulated heat stable protein 1, 24kDa
dog(610212) calcium regulated heat stable protein 1, 24kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042476 Rosetta Predictions human pricing
NM_014316 Rosetta Predictions human pricing
NM_152790 Rosetta Predictions rat pricing
NM_025821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310038 predicted 1084
2 SASI_Hs02_00310039 predicted 1221
3 SASI_Hs02_00310040 predicted 893
4 SASI_Hs02_00310041 predicted 976
5 SASI_Hs02_00310042 predicted 559
6 SASI_Hs02_00310043 predicted 1219
7 SASI_Hs02_00310044 predicted 899
8 SASI_Hs02_00310045 predicted 1085
9 SASI_Hs02_00310046 predicted 977
10 SASI_Hs02_00310047 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345412 predicted 788
2 SASI_Hs02_00345413 predicted 915
3 SASI_Hs02_00345414 predicted 596
4 SASI_Hs02_00345415 predicted 674
5 SASI_Hs01_00052482 predicted 260
6 SASI_Hs02_00345416 predicted 916
7 SASI_Hs02_00345417 predicted 592
8 SASI_Hs02_00345418 predicted 791
9 SASI_Hs02_00345419 predicted 681
10 SASI_Hs02_00345420 predicted 703
11 SASI_Hs01_00052478 predicted 316
12 SASI_Hs01_00052479 predicted 374
13 SASI_Hs01_00052480 predicted 430
14 SASI_Hs01_00052481 predicted 438
15 SASI_Hs01_00052483 predicted 381
16 SASI_Hs01_00052484 predicted 370
17 SASI_Hs01_00052485 predicted 324
18 SASI_Hs01_00052486 predicted 372
19 SASI_Hs01_00052487 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066448 predicted 295
2 SASI_Rn01_00066449 predicted 226
3 SASI_Rn01_00066450 predicted 378
4 SASI_Rn01_00066451 predicted 280
5 SASI_Rn01_00066452 predicted 305
6 SASI_Rn01_00066453 predicted 911
7 SASI_Rn01_00066454 predicted 847
8 SASI_Rn01_00066455 predicted 867
9 SASI_Rn01_00066456 predicted 782
10 SASI_Rn01_00066457 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092476 predicted 831
2 SASI_Mm01_00092477 predicted 839
3 SASI_Mm01_00092478 predicted 992
4 SASI_Mm02_00329078 predicted 986
5 SASI_Mm01_00092480 predicted 303
6 SASI_Mm01_00092481 predicted 875
7 SASI_Mm01_00092482 predicted 366
8 SASI_Mm01_00092483 predicted 225
9 SASI_Mm01_00092484 predicted 824
10 SASI_Mm01_00092485 predicted 286
11 SASI_Mm01_00092479 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014316
VALIDATED
CARHSP1 MISSION shRNA Bacterial Glycerol Stock
calcium regulated heat stable protein 1, 24kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-487s21c1
Sequence:CCGGTCCTAGGAGATGGTGGAAGCACTCGAGTGCTTCCACCATCTCCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014316.2-233s21c1
Sequence:CCGGTCTACAAAGGAGTCTGCAAATCTCGAGATTTGCAGACTCCTTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014316.2-459s21c1
Sequence:CCGGTGAGACCTGGTCTGGACATGTCTCGAGACATGTCCAGACCAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-358s21c1
Sequence:CCGGGGCGACGAGGTCACCTATAAACTCGAGTTTATAGGTGACCTCGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-385s21c1
Sequence:CCGGTCCATCCCACCCAAGAATGAGCTCGAGCTCATTCTTGGGTGGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-266s21c1
Sequence:CCGGCCAAGGGCCATGGCTTCATTACTCGAGTAATGAAGCCATGGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014316.2-923s21c1
Sequence:CCGGTGACTTCTCCAAGGCAAATTTCTCGAGAAATTTGCCTTGGAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-195s1c1
Sequence:CCGGGTCTACAAAGGAGTCTGCAAACTCGAGTTTGCAGACTCCTTTGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014316.1-318s1c1
Sequence:CCGGGAAGGCGACGAGGTCACCTATCTCGAGATAGGTGACCTCGTCGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-50s1c1
Sequence:CCGGCCATCAAGCTTCAGTCGGGCTCTCGAGAGCCCGACTGAAGCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-270s1c1
Sequence:CCGGGACATCTTCCTGCACATCTCTCTCGAGAGAGATGTGCAGGAAGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014316
VALIDATED
CARHSP1 MISSION shRNA shRNA Plasmid DNA
calcium regulated heat stable protein 1, 24kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-487s21c1
Sequence:CCGGTCCTAGGAGATGGTGGAAGCACTCGAGTGCTTCCACCATCTCCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014316.2-233s21c1
Sequence:CCGGTCTACAAAGGAGTCTGCAAATCTCGAGATTTGCAGACTCCTTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014316.2-459s21c1
Sequence:CCGGTGAGACCTGGTCTGGACATGTCTCGAGACATGTCCAGACCAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-358s21c1
Sequence:CCGGGGCGACGAGGTCACCTATAAACTCGAGTTTATAGGTGACCTCGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-385s21c1
Sequence:CCGGTCCATCCCACCCAAGAATGAGCTCGAGCTCATTCTTGGGTGGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-266s21c1
Sequence:CCGGCCAAGGGCCATGGCTTCATTACTCGAGTAATGAAGCCATGGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014316.2-923s21c1
Sequence:CCGGTGACTTCTCCAAGGCAAATTTCTCGAGAAATTTGCCTTGGAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-195s1c1
Sequence:CCGGGTCTACAAAGGAGTCTGCAAACTCGAGTTTGCAGACTCCTTTGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014316.1-318s1c1
Sequence:CCGGGAAGGCGACGAGGTCACCTATCTCGAGATAGGTGACCTCGTCGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-50s1c1
Sequence:CCGGCCATCAAGCTTCAGTCGGGCTCTCGAGAGCCCGACTGAAGCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-270s1c1
Sequence:CCGGGACATCTTCCTGCACATCTCTCTCGAGAGAGATGTGCAGGAAGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014316
VALIDATED
CARHSP1 MISSION shRNA Lentiviral Transduction Particles
calcium regulated heat stable protein 1, 24kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-487s21c1
Sequence:CCGGTCCTAGGAGATGGTGGAAGCACTCGAGTGCTTCCACCATCTCCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014316.2-233s21c1
Sequence:CCGGTCTACAAAGGAGTCTGCAAATCTCGAGATTTGCAGACTCCTTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014316.2-459s21c1
Sequence:CCGGTGAGACCTGGTCTGGACATGTCTCGAGACATGTCCAGACCAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-358s21c1
Sequence:CCGGGGCGACGAGGTCACCTATAAACTCGAGTTTATAGGTGACCTCGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-385s21c1
Sequence:CCGGTCCATCCCACCCAAGAATGAGCTCGAGCTCATTCTTGGGTGGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014316.2-266s21c1
Sequence:CCGGCCAAGGGCCATGGCTTCATTACTCGAGTAATGAAGCCATGGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014316.2-923s21c1
Sequence:CCGGTGACTTCTCCAAGGCAAATTTCTCGAGAAATTTGCCTTGGAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-195s1c1
Sequence:CCGGGTCTACAAAGGAGTCTGCAAACTCGAGTTTGCAGACTCCTTTGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014316.1-318s1c1
Sequence:CCGGGAAGGCGACGAGGTCACCTATCTCGAGATAGGTGACCTCGTCGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-50s1c1
Sequence:CCGGCCATCAAGCTTCAGTCGGGCTCTCGAGAGCCCGACTGAAGCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014316.1-270s1c1
Sequence:CCGGGACATCTTCCTGCACATCTCTCTCGAGAGAGATGTGCAGGAAGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025821
VALIDATED
CARHSP1 MISSION shRNA Bacterial Glycerol Stock
calcium regulated heat stable protein 1, 24kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-85s21c1
Sequence:CCGGCCCACGCATCAGACTTCTGTACTCGAGTACAGAAGTCTGATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025821.2-795s21c1
Sequence:CCGGAGTAGGTCAAACGTGCTATTTCTCGAGAAATAGCACGTTTGACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025821.2-363s21c1
Sequence:CCGGCGACGAAGTCACCTATAAGATCTCGAGATCTTATAGGTGACTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-233s21c1
Sequence:CCGGCCGTCTACAAAGGAGTCTGTACTCGAGTACAGACTCCTTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-834s21c1
Sequence:CCGGATCAAGCCTGTAAGGACTATTCTCGAGAATAGTCCTTACAGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025821.2-2136s1c1
Sequence:CCGGCCTAGCTTATTTGGCGAGTTTCTCGAGAAACTCGCCAAATAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-363s1c1
Sequence:CCGGCGACGAAGTCACCTATAAGATCTCGAGATCTTATAGGTGACTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-85s1c1
Sequence:CCGGCCCACGCATCAGACTTCTGTACTCGAGTACAGAAGTCTGATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-372s1c1
Sequence:CCGGCACCTATAAGATGTGCTCTATCTCGAGATAGAGCACATCTTATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-233s1c1
Sequence:CCGGCCGTCTACAAAGGAGTCTGTACTCGAGTACAGACTCCTTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025821
VALIDATED
CARHSP1 MISSION shRNA shRNA Plasmid DNA
calcium regulated heat stable protein 1, 24kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-85s21c1
Sequence:CCGGCCCACGCATCAGACTTCTGTACTCGAGTACAGAAGTCTGATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025821.2-795s21c1
Sequence:CCGGAGTAGGTCAAACGTGCTATTTCTCGAGAAATAGCACGTTTGACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025821.2-363s21c1
Sequence:CCGGCGACGAAGTCACCTATAAGATCTCGAGATCTTATAGGTGACTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-233s21c1
Sequence:CCGGCCGTCTACAAAGGAGTCTGTACTCGAGTACAGACTCCTTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-834s21c1
Sequence:CCGGATCAAGCCTGTAAGGACTATTCTCGAGAATAGTCCTTACAGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025821.2-2136s1c1
Sequence:CCGGCCTAGCTTATTTGGCGAGTTTCTCGAGAAACTCGCCAAATAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-363s1c1
Sequence:CCGGCGACGAAGTCACCTATAAGATCTCGAGATCTTATAGGTGACTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-85s1c1
Sequence:CCGGCCCACGCATCAGACTTCTGTACTCGAGTACAGAAGTCTGATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-372s1c1
Sequence:CCGGCACCTATAAGATGTGCTCTATCTCGAGATAGAGCACATCTTATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-233s1c1
Sequence:CCGGCCGTCTACAAAGGAGTCTGTACTCGAGTACAGACTCCTTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025821
VALIDATED
CARHSP1 MISSION shRNA Lentiviral Transduction Particles
calcium regulated heat stable protein 1, 24kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-85s21c1
Sequence:CCGGCCCACGCATCAGACTTCTGTACTCGAGTACAGAAGTCTGATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025821.2-795s21c1
Sequence:CCGGAGTAGGTCAAACGTGCTATTTCTCGAGAAATAGCACGTTTGACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025821.2-363s21c1
Sequence:CCGGCGACGAAGTCACCTATAAGATCTCGAGATCTTATAGGTGACTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-233s21c1
Sequence:CCGGCCGTCTACAAAGGAGTCTGTACTCGAGTACAGACTCCTTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025821.2-834s21c1
Sequence:CCGGATCAAGCCTGTAAGGACTATTCTCGAGAATAGTCCTTACAGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025821.2-2136s1c1
Sequence:CCGGCCTAGCTTATTTGGCGAGTTTCTCGAGAAACTCGCCAAATAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-363s1c1
Sequence:CCGGCGACGAAGTCACCTATAAGATCTCGAGATCTTATAGGTGACTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-85s1c1
Sequence:CCGGCCCACGCATCAGACTTCTGTACTCGAGTACAGAAGTCTGATGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-372s1c1
Sequence:CCGGCACCTATAAGATGTGCTCTATCTCGAGATAGAGCACATCTTATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025821.2-233s1c1
Sequence:CCGGCCGTCTACAAAGGAGTCTGTACTCGAGTACAGACTCCTTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks