EMAIL THIS PAGE TO A FRIEND

CARKD

carbohydrate kinase domain containing

47 Gene Product Result for
Synonyms: LP3298
UniProtKB ID: Q8IW45, B4DXT4, Q5T9X3, Q9H7W1, Q9NVF5
Gene ID:
Mouse(69225) carbohydrate kinase domain containing
Rat(361185) carbohydrate kinase domain containing
domestic guinea pig(100729574) carbohydrate kinase domain containing
naked mole-rat(101717804) carbohydrate kinase domain containing
sheep(101116066) carbohydrate kinase domain containing
chicken(418755) carbohydrate kinase domain containing
domestic cat(101096534) carbohydrate kinase domain containing
cow(613996) carbohydrate kinase domain containing
dog(607381) carbohydrate kinase domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014821 MISSION® esiRNA esiRNA targeting mouse Carkd (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018210 Rosetta Predictions human pricing
NM_001108402 Rosetta Predictions rat pricing
NM_026995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207753 predicted 311
2 SASI_Hs01_00207754 predicted 937
3 SASI_Hs01_00207755 predicted 1320
4 SASI_Hs01_00207756 predicted 1407
5 SASI_Hs01_00207757 predicted 1427
6 SASI_Hs01_00207758 predicted 1382
7 SASI_Hs01_00207759 predicted 1369
8 SASI_Hs01_00207762 predicted 646
9 SASI_Hs01_00207760 predicted 300
10 SASI_Hs01_00207761 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238309 predicted 1017
2 SASI_Rn02_00238310 predicted 483
3 SASI_Rn02_00238311 predicted 257
4 SASI_Rn02_00238312 predicted 924
5 SASI_Rn02_00238313 predicted 942
6 SASI_Rn02_00238314 predicted 577
7 SASI_Rn02_00238315 predicted 885
8 SASI_Rn02_00238316 predicted 302
9 SASI_Rn02_00238317 predicted 345
10 SASI_Rn02_00238318 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111924 predicted 489
2 SASI_Mm01_00111925 predicted 305
3 SASI_Mm01_00111926 predicted 332
4 SASI_Mm01_00111927 predicted 1020
5 SASI_Mm01_00111928 predicted 805
6 SASI_Mm01_00111929 predicted 319
7 SASI_Mm01_00111931 predicted 413
8 SASI_Mm01_00111932 predicted 964
9 SASI_Mm01_00111933 predicted 377
10 SASI_Mm02_00331354 predicted 328
11 SASI_Mm01_00111930 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018210
CARKD MISSION shRNA Bacterial Glycerol Stock
carbohydrate kinase domain containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018210.1-2460s1c1
Sequence:CCGGCCAGATGGATTCTACTTTCTTCTCGAGAAGAAAGTAGAATCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-227s1c1
Sequence:CCGGGCAAGATGGAAGAATAGGCGTCTCGAGACGCCTATTCTTCCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-176s1c1
Sequence:CCGGGCAGCTGGTGAGAAATATCATCTCGAGATGATATTTCTCACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018210.1-1312s1c1
Sequence:CCGGGAGCATAAATTGGTTGCCATTCTCGAGAATGGCAACCAATTTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-495s1c1
Sequence:CCGGCTCAGAAATGTCCAGGGCATTCTCGAGAATGCCCTGGACATTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-137s21c1
Sequence:CCGGACGTAAAGCACATTCGATAAACTCGAGTTTATCGAATGTGCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018210.2-1389s21c1
Sequence:CCGGAGATGTTATGGCGACACTAAACTCGAGTTTAGTGTCGCCATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-289s21c1
Sequence:CCGGCAGCAATCTCAGCTCTCAAAGCTCGAGCTTTGAGAGCTGAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-917s21c1
Sequence:CCGGAGACTTGAAATTGACAATTTGCTCGAGCAAATTGTCAATTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-637s21c1
Sequence:CCGGTGGAGTTCAGCAGACTGTATGCTCGAGCATACAGTCTGCTGAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018210
CARKD MISSION shRNA shRNA Plasmid DNA
carbohydrate kinase domain containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018210.1-2460s1c1
Sequence:CCGGCCAGATGGATTCTACTTTCTTCTCGAGAAGAAAGTAGAATCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-227s1c1
Sequence:CCGGGCAAGATGGAAGAATAGGCGTCTCGAGACGCCTATTCTTCCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-176s1c1
Sequence:CCGGGCAGCTGGTGAGAAATATCATCTCGAGATGATATTTCTCACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018210.1-1312s1c1
Sequence:CCGGGAGCATAAATTGGTTGCCATTCTCGAGAATGGCAACCAATTTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-495s1c1
Sequence:CCGGCTCAGAAATGTCCAGGGCATTCTCGAGAATGCCCTGGACATTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-137s21c1
Sequence:CCGGACGTAAAGCACATTCGATAAACTCGAGTTTATCGAATGTGCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018210.2-1389s21c1
Sequence:CCGGAGATGTTATGGCGACACTAAACTCGAGTTTAGTGTCGCCATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-289s21c1
Sequence:CCGGCAGCAATCTCAGCTCTCAAAGCTCGAGCTTTGAGAGCTGAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-917s21c1
Sequence:CCGGAGACTTGAAATTGACAATTTGCTCGAGCAAATTGTCAATTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-637s21c1
Sequence:CCGGTGGAGTTCAGCAGACTGTATGCTCGAGCATACAGTCTGCTGAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018210
CARKD MISSION shRNA Lentiviral Transduction Particles
carbohydrate kinase domain containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018210.1-2460s1c1
Sequence:CCGGCCAGATGGATTCTACTTTCTTCTCGAGAAGAAAGTAGAATCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-227s1c1
Sequence:CCGGGCAAGATGGAAGAATAGGCGTCTCGAGACGCCTATTCTTCCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-176s1c1
Sequence:CCGGGCAGCTGGTGAGAAATATCATCTCGAGATGATATTTCTCACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018210.1-1312s1c1
Sequence:CCGGGAGCATAAATTGGTTGCCATTCTCGAGAATGGCAACCAATTTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018210.1-495s1c1
Sequence:CCGGCTCAGAAATGTCCAGGGCATTCTCGAGAATGCCCTGGACATTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-137s21c1
Sequence:CCGGACGTAAAGCACATTCGATAAACTCGAGTTTATCGAATGTGCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018210.2-1389s21c1
Sequence:CCGGAGATGTTATGGCGACACTAAACTCGAGTTTAGTGTCGCCATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-289s21c1
Sequence:CCGGCAGCAATCTCAGCTCTCAAAGCTCGAGCTTTGAGAGCTGAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-917s21c1
Sequence:CCGGAGACTTGAAATTGACAATTTGCTCGAGCAAATTGTCAATTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018210.2-637s21c1
Sequence:CCGGTGGAGTTCAGCAGACTGTATGCTCGAGCATACAGTCTGCTGAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026995
VALIDATED
CARKD MISSION shRNA Bacterial Glycerol Stock
carbohydrate kinase domain containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000241169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-163s21c1
Sequence:CCGGCATACAGCACATGCGACAAAGCTCGAGCTTTGTCGCATGTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026995.3-1103s21c1
Sequence:CCGGACAGACTGAATCCTCCATTTGCTCGAGCAAATGGAGGATTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-613s21c1
Sequence:CCGGCCAGCCCTCATCCATAGTTACCTCGAGGTAACTATGGATGAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-509s21c1
Sequence:CCGGATGACCTTCTTCTCAACAATGCTCGAGCATTGTTGAGAAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026995
VALIDATED
CARKD MISSION shRNA shRNA Plasmid DNA
carbohydrate kinase domain containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000241169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-163s21c1
Sequence:CCGGCATACAGCACATGCGACAAAGCTCGAGCTTTGTCGCATGTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026995.3-1103s21c1
Sequence:CCGGACAGACTGAATCCTCCATTTGCTCGAGCAAATGGAGGATTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-613s21c1
Sequence:CCGGCCAGCCCTCATCCATAGTTACCTCGAGGTAACTATGGATGAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-509s21c1
Sequence:CCGGATGACCTTCTTCTCAACAATGCTCGAGCATTGTTGAGAAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026995
VALIDATED
CARKD MISSION shRNA Lentiviral Transduction Particles
carbohydrate kinase domain containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000241169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-163s21c1
Sequence:CCGGCATACAGCACATGCGACAAAGCTCGAGCTTTGTCGCATGTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026995.3-1103s21c1
Sequence:CCGGACAGACTGAATCCTCCATTTGCTCGAGCAAATGGAGGATTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-613s21c1
Sequence:CCGGCCAGCCCTCATCCATAGTTACCTCGAGGTAACTATGGATGAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026995.3-509s21c1
Sequence:CCGGATGACCTTCTTCTCAACAATGCTCGAGCATTGTTGAGAAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks