EMAIL THIS PAGE TO A FRIEND

CARM1

coactivator-associated arginine methyltransferase 1

130 Gene Product Result for
Synonyms: PRMT4
UniProtKB ID: Q86X55, A6NN38
Gene ID:
Human(10498) Summary: Protein arginine N-methyltransferases, such as CARM1, catalyze the transfer of a methyl group from S-adenosyl-L-methionine to the side chain nitrogens of arginine residues within proteins to form methylated arginine derivatives and S-adenosyl-L-homocysteine. Protein arginine methylation has been implicated in signal transduction, metabolism of nascent pre-RNA, and transcriptional activation (Frankel et al., 2002 [PubMed 11724789]
Mouse(59035) coactivator-associated arginine methyltransferase 1
Rat(363026) coactivator-associated arginine methyltransferase 1
sheep(101119559) coactivator-associated arginine methyltransferase 1
naked mole-rat(101708177) coactivator-associated arginine methyltransferase 1
domestic guinea pig(100723682) coactivator-associated arginine methyltransferase 1
Zebrafish(445251) coactivator-associated arginine methyltransferase 1
cow(784795) coactivator-associated arginine methyltransferase 1
Horse(100057509) coactivator-associated arginine methyltransferase 1
domestic cat(101101033) coactivator-associated arginine methyltransferase 1
dog(484947) coactivator-associated arginine methyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199141 Rosetta Predictions human pricing
NM_001030041 Rosetta Predictions rat pricing
NM_001034086 Rosetta Predictions rat pricing
NM_001034087 Rosetta Predictions rat pricing
NM_001034088 Rosetta Predictions rat pricing
NM_021531 Rosetta Predictions mouse pricing
NM_153141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023191 predicted 1230
2 SASI_Hs01_00023193 predicted 1508
3 SASI_Hs02_00372585 predicted 1428
4 SASI_Hs01_00023194 predicted 1670
5 SASI_Hs01_00023195 predicted 1211
6 SASI_Hs01_00023196 predicted 1302
7 SASI_Hs01_00023197 predicted 477
8 SASI_Hs01_00023198 predicted 1587
9 SASI_Hs01_00023199 predicted 1717
10 SASI_Hs01_00023200 predicted 898
11 SASI_Hs01_00023192 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042592 predicted 1195
2 SASI_Rn01_00042593 predicted 1423
3 SASI_Rn01_00042594 predicted 1204
4 SASI_Rn01_00042595 predicted 1478
5 SASI_Rn01_00042596 predicted 811
6 SASI_Rn01_00042597 predicted 1272
7 SASI_Rn01_00042598 predicted 863
8 SASI_Rn01_00042599 predicted 1180
9 SASI_Rn01_00042600 predicted 976
10 SASI_Rn01_00042601 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072946 predicted 1205
2 SASI_Rn01_00072947 predicted 1434
3 SASI_Rn01_00072948 predicted 1213
4 SASI_Rn01_00072949 predicted 1481
5 SASI_Rn01_00072950 predicted 817
6 SASI_Rn01_00072951 predicted 1278
7 SASI_Rn01_00072952 predicted 876
8 SASI_Rn01_00072953 predicted 1186
9 SASI_Rn01_00072954 predicted 987
10 SASI_Rn01_00072955 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111161 predicted 1198
2 SASI_Rn01_00111162 predicted 1426
3 SASI_Rn01_00111163 predicted 1206
4 SASI_Rn01_00111164 predicted 1479
5 SASI_Rn01_00111165 predicted 811
6 SASI_Rn01_00111166 predicted 1270
7 SASI_Rn01_00111167 predicted 876
8 SASI_Rn01_00111168 predicted 1184
9 SASI_Rn01_00111169 predicted 990
10 SASI_Rn01_00111170 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072788 predicted 1193
2 SASI_Rn01_00072789 predicted 1429
3 SASI_Rn01_00072790 predicted 1208
4 SASI_Rn01_00072791 predicted 1480
5 SASI_Rn01_00072792 predicted 812
6 SASI_Rn01_00072793 predicted 1266
7 SASI_Rn01_00072794 predicted 869
8 SASI_Rn01_00072795 predicted 1179
9 SASI_Rn01_00072796 predicted 984
10 SASI_Rn01_00072797 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193300 predicted 1451
2 SASI_Mm01_00193301 predicted 1183
3 SASI_Mm01_00193302 predicted 1233
4 SASI_Mm01_00193303 predicted 833
5 SASI_Mm01_00193304 predicted 1222
6 SASI_Mm01_00193305 predicted 887
7 SASI_Mm01_00193306 predicted 1288
8 SASI_Mm01_00193308 predicted 1210
9 SASI_Mm01_00193309 predicted 1450
10 SASI_Mm02_00326268 predicted 1501
11 SASI_Mm01_00193307 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343018 predicted 1448
2 SASI_Mm02_00343019 predicted 1181
3 SASI_Mm02_00343020 predicted 1226
4 SASI_Mm02_00343021 predicted 833
5 SASI_Mm02_00343022 predicted 1216
6 SASI_Mm02_00343023 predicted 889
7 SASI_Mm02_00343024 predicted 1295
8 SASI_Mm02_00343025 predicted 1203
9 SASI_Mm02_00343026 predicted 1456
10 SASI_Mm02_00343027 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199141
VALIDATED
CARM1 MISSION shRNA Bacterial Glycerol Stock
coactivator-associated arginine methyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199141.1-1305s21c1
Sequence:GTACCGGTGCTTTCATCGGCTCCATAATCTCGAGATTATGGAGCCGATGAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_199141.1-603s21c1
Sequence:CCGGGCAGAACATGATGCAGGACTACTCGAGTAGTCCTGCATCATGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199141.1-2075s21c1
Sequence:CCGGCTATGGGAACTGGGACACTTTCTCGAGAAAGTGTCCCAGTTCCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199141.1-1677s21c1
Sequence:CCGGCTATGACTTGAGCAGTGTTATCTCGAGATAACACTGCTCAAGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_199141.1-471s21c1
Sequence:CCGGCGATTTCTGTTCCTTCTACAACTCGAGTTGTAGAAGGAACAGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_199141.1-603s1c1
Sequence:CCGGGCAGAACATGATGCAGGACTACTCGAGTAGTCCTGCATCATGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_199141.1-1677s1c1
Sequence:CCGGCTATGACTTGAGCAGTGTTATCTCGAGATAACACTGCTCAAGTCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199141.1-1718s1c1
Sequence:CCGGGCCACAACAACCTGATTCCTTCTCGAGAAGGAATCAGGTTGTTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199141
VALIDATED
CARM1 MISSION shRNA shRNA Plasmid DNA
coactivator-associated arginine methyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199141.1-1305s21c1
Sequence:GTACCGGTGCTTTCATCGGCTCCATAATCTCGAGATTATGGAGCCGATGAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_199141.1-603s21c1
Sequence:CCGGGCAGAACATGATGCAGGACTACTCGAGTAGTCCTGCATCATGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199141.1-2075s21c1
Sequence:CCGGCTATGGGAACTGGGACACTTTCTCGAGAAAGTGTCCCAGTTCCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199141.1-1677s21c1
Sequence:CCGGCTATGACTTGAGCAGTGTTATCTCGAGATAACACTGCTCAAGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_199141.1-471s21c1
Sequence:CCGGCGATTTCTGTTCCTTCTACAACTCGAGTTGTAGAAGGAACAGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_199141.1-603s1c1
Sequence:CCGGGCAGAACATGATGCAGGACTACTCGAGTAGTCCTGCATCATGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_199141.1-1677s1c1
Sequence:CCGGCTATGACTTGAGCAGTGTTATCTCGAGATAACACTGCTCAAGTCATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199141.1-1718s1c1
Sequence:CCGGGCCACAACAACCTGATTCCTTCTCGAGAAGGAATCAGGTTGTTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199141
VALIDATED
CARM1 MISSION shRNA Lentiviral Transduction Particles
coactivator-associated arginine methyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199141.1-1305s21c1
Sequence:GTACCGGTGCTTTCATCGGCTCCATAATCTCGAGATTATGGAGCCGATGAAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_199141.1-603s21c1
Sequence:CCGGGCAGAACATGATGCAGGACTACTCGAGTAGTCCTGCATCATGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199141.1-2075s21c1
Sequence:CCGGCTATGGGAACTGGGACACTTTCTCGAGAAAGTGTCCCAGTTCCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199141.1-1677s21c1
Sequence:CCGGCTATGACTTGAGCAGTGTTATCTCGAGATAACACTGCTCAAGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_199141.1-471s21c1
Sequence:CCGGCGATTTCTGTTCCTTCTACAACTCGAGTTGTAGAAGGAACAGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_199141.1-603s1c1
Sequence:CCGGGCAGAACATGATGCAGGACTACTCGAGTAGTCCTGCATCATGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_199141.1-1677s1c1
Sequence:CCGGCTATGACTTGAGCAGTGTTATCTCGAGATAACACTGCTCAAGTCATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199141.1-1718s1c1
Sequence:CCGGGCCACAACAACCTGATTCCTTCTCGAGAAGGAATCAGGTTGTTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021531
VALIDATED
CARM1 MISSION shRNA Bacterial Glycerol Stock
coactivator-associated arginine methyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-245s1c1
Sequence:CCGGGCCATGAAGATGTGTGTGTTTCTCGAGAAACACACACATCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-1821s1c1
Sequence:CCGGCCCGACCAACACCATGCACTACTCGAGTAGTGCATGGTGTTGGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-369s1c1
Sequence:CCGGCCACGATTTCTGTTCTTTCTACTCGAGTAGAAAGAACAGAAATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021531.1-1636s1c1
Sequence:CCGGCCCTTAGCTAACACAGGGATTCTCGAGAATCCCTGTGTTAGCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021531.1-1204s1c1
Sequence:CCGGGTTGCTTTCATTGGCTCCATACTCGAGTATGGAGCCAATGAAAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021531
VALIDATED
CARM1 MISSION shRNA shRNA Plasmid DNA
coactivator-associated arginine methyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-245s1c1
Sequence:CCGGGCCATGAAGATGTGTGTGTTTCTCGAGAAACACACACATCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-1821s1c1
Sequence:CCGGCCCGACCAACACCATGCACTACTCGAGTAGTGCATGGTGTTGGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-369s1c1
Sequence:CCGGCCACGATTTCTGTTCTTTCTACTCGAGTAGAAAGAACAGAAATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021531.1-1636s1c1
Sequence:CCGGCCCTTAGCTAACACAGGGATTCTCGAGAATCCCTGTGTTAGCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021531.1-1204s1c1
Sequence:CCGGGTTGCTTTCATTGGCTCCATACTCGAGTATGGAGCCAATGAAAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021531
VALIDATED
CARM1 MISSION shRNA Lentiviral Transduction Particles
coactivator-associated arginine methyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-245s1c1
Sequence:CCGGGCCATGAAGATGTGTGTGTTTCTCGAGAAACACACACATCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-1821s1c1
Sequence:CCGGCCCGACCAACACCATGCACTACTCGAGTAGTGCATGGTGTTGGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021531.1-369s1c1
Sequence:CCGGCCACGATTTCTGTTCTTTCTACTCGAGTAGAAAGAACAGAAATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021531.1-1636s1c1
Sequence:CCGGCCCTTAGCTAACACAGGGATTCTCGAGAATCCCTGTGTTAGCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021531.1-1204s1c1
Sequence:CCGGGTTGCTTTCATTGGCTCCATACTCGAGTATGGAGCCAATGAAAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)