EMAIL THIS PAGE TO A FRIEND

CARNS1

carnosine synthase 1

97 Gene Product Result for
Synonyms: ATPGD1
UniProtKB ID: A5YM72, A8K1M3, Q8N467, Q9P2F3
Gene ID:
Human(57571) Summary: CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]
Mouse(107239) carnosine synthase 1
chicken(100359387) carnosine synthase 1
dog(483695) carnosine synthase 1
domestic cat(101080661) carnosine synthase 1
cow(783525) carnosine synthase 1
Horse(100059309) carnosine synthase 1
domestic guinea pig(100733118) carnosine synthase 1
naked mole-rat(101703269) carnosine synthase 1
sheep(101109312) carnosine synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020811 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU183221 MISSION® esiRNA esiRNA targeting mouse Carns1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020811 Rosetta Predictions human pricing
XM_208522 Rosetta Predictions human pricing
XM_934701 Rosetta Predictions human pricing
XM_902445 Rosetta Predictions mouse pricing
XM_919865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353994 predicted 2783
2 SASI_Hs02_00353995 predicted 2903
3 SASI_Hs02_00353996 predicted 1100
4 SASI_Hs02_00353997 predicted 2319
5 SASI_Hs02_00353998 predicted 2230
6 SASI_Hs02_00353999 predicted 2339
7 SASI_Hs02_00354000 predicted 2244
8 SASI_Hs02_00354001 predicted 558
9 SASI_Hs02_00354002 predicted 912
10 SASI_Hs02_00354003 predicted 2878
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256174 predicted 3909
2 SASI_Hs01_00256175 predicted 4029
3 SASI_Hs01_00256176 predicted 3438
4 SASI_Hs01_00256177 predicted 3355
5 SASI_Hs01_00256178 predicted 3466
6 SASI_Hs01_00256179 predicted 3360
7 SASI_Hs01_00256180 predicted 4005
8 SASI_Hs01_00256181 predicted 3591
9 SASI_Hs01_00256182 predicted 3272
10 SASI_Hs01_00256183 predicted 4036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295602 predicted 1185
2 SASI_Hs01_00295603 predicted 1308
3 SASI_Hs01_00295604 predicted 715
4 SASI_Hs01_00295605 predicted 636
5 SASI_Hs01_00295606 predicted 731
6 SASI_Hs01_00295607 predicted 639
7 SASI_Hs01_00295608 predicted 1275
8 SASI_Hs01_00295609 predicted 552
9 SASI_Hs01_00295610 predicted 1304
10 SASI_Hs01_00295611 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430236 predicted 587
2 SASI_Mm02_00430237 predicted 2488
3 SASI_Mm02_00430238 predicted 583
4 SASI_Mm02_00430239 predicted 2620
5 SASI_Mm02_00430240 predicted 1475
6 SASI_Mm02_00430241 predicted 1474
7 SASI_Mm02_00430242 predicted 2030
8 SASI_Mm02_00430243 predicted 1590
9 SASI_Mm02_00430244 predicted 1956
10 SASI_Mm02_00430245 predicted 1971
11 SASI_Mm01_00209533 predicted 1589
12 SASI_Mm01_00209534 predicted 868
13 SASI_Mm01_00209535 predicted 870
14 SASI_Mm01_00209536 predicted 1579
15 SASI_Mm01_00209537 predicted 1640
16 SASI_Mm01_00209538 predicted 1566
17 SASI_Mm01_00209539 predicted 1621
18 SASI_Mm01_00209540 predicted 1600
19 SASI_Mm01_00209541 predicted 1569
20 SASI_Mm01_00209542 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442441 predicted 197
2 SASI_Mm02_00442442 predicted 777
3 SASI_Mm02_00442443 predicted 2681
4 SASI_Mm02_00442444 predicted 779
5 SASI_Mm02_00442445 predicted 2810
6 SASI_Mm02_00442446 predicted 1657
7 SASI_Mm02_00442447 predicted 1661
8 SASI_Mm02_00442448 predicted 2220
9 SASI_Mm02_00442449 predicted 1779
10 SASI_Mm02_00442450 predicted 2149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020811
CARNS1 MISSION shRNA Bacterial Glycerol Stock
carnosine synthase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2284s21c1
Sequence:CCGGACGTGGACCTGGTGTTGTTTGCTCGAGCAAACAACACCAGGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-562s21c1
Sequence:CCGGTGACATTCCTGGATGACTTTGCTCGAGCAAAGTCATCCAGGAATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2320s21c1
Sequence:CCGGCTGCCTTTGTCTCCGACAATGCTCGAGCATTGTCGGAGACAAAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2537s21c1
Sequence:CCGGTGGCTTCTACCTGCGTGATTGCTCGAGCAATCACGCAGGTAGAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020811.1-3074s21c1
Sequence:CCGGCCAGAGCAGCAGGGCAATTTACTCGAGTAAATTGCCCTGCTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020811
CARNS1 MISSION shRNA shRNA Plasmid DNA
carnosine synthase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2284s21c1
Sequence:CCGGACGTGGACCTGGTGTTGTTTGCTCGAGCAAACAACACCAGGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-562s21c1
Sequence:CCGGTGACATTCCTGGATGACTTTGCTCGAGCAAAGTCATCCAGGAATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2320s21c1
Sequence:CCGGCTGCCTTTGTCTCCGACAATGCTCGAGCATTGTCGGAGACAAAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2537s21c1
Sequence:CCGGTGGCTTCTACCTGCGTGATTGCTCGAGCAATCACGCAGGTAGAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020811.1-3074s21c1
Sequence:CCGGCCAGAGCAGCAGGGCAATTTACTCGAGTAAATTGCCCTGCTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020811
CARNS1 MISSION shRNA Lentiviral Transduction Particles
carnosine synthase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2284s21c1
Sequence:CCGGACGTGGACCTGGTGTTGTTTGCTCGAGCAAACAACACCAGGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-562s21c1
Sequence:CCGGTGACATTCCTGGATGACTTTGCTCGAGCAAAGTCATCCAGGAATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2320s21c1
Sequence:CCGGCTGCCTTTGTCTCCGACAATGCTCGAGCATTGTCGGAGACAAAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020811.1-2537s21c1
Sequence:CCGGTGGCTTCTACCTGCGTGATTGCTCGAGCAATCACGCAGGTAGAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020811.1-3074s21c1
Sequence:CCGGCCAGAGCAGCAGGGCAATTTACTCGAGTAAATTGCCCTGCTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)