EMAIL THIS PAGE TO A FRIEND

CARS2

cysteinyl-tRNA synthetase 2, mitochondrial (putative)

68 Gene Product Result for
UniProtKB ID: Q9HA77, Q8NI84, Q96IV4
Gene ID:
Mouse(71941) cysteinyl-tRNA synthetase 2 (mitochondrial)(putative)
Rat(361184) cysteinyl-tRNA synthetase 2, mitochondrial
Zebrafish(555187) cysteinyl-tRNA synthetase 2, mitochondrial
domestic cat(101096783) cysteinyl-tRNA synthetase 2, mitochondrial (putative)
dog(476983) cysteinyl-tRNA synthetase 2, mitochondrial (putative)
chicken(418757) cysteinyl-tRNA synthetase 2, mitochondrial (putative)
domestic guinea pig(100729294) cysteinyl-tRNA synthetase 2, mitochondrial (putative)
naked mole-rat(101716679) cysteinyl-tRNA synthetase 2, mitochondrial (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081241 MISSION® esiRNA esiRNA human CARS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024537 Rosetta Predictions human pricing
XM_001076059 Rosetta Predictions rat pricing
XM_341467 Rosetta Predictions rat pricing
NM_024248 Rosetta Predictions mouse pricing
XM_976303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064590 predicted 799
2 SASI_Hs01_00064591 predicted 864
3 SASI_Hs01_00064592 predicted 815
4 SASI_Hs01_00064593 predicted 830
5 SASI_Hs02_00356829 predicted 937
6 SASI_Hs01_00064594 predicted 1408
7 SASI_Hs02_00356830 predicted 369
8 SASI_Hs01_00064596 predicted 1002
9 SASI_Hs01_00064597 predicted 553
10 SASI_Hs02_00356831 predicted 594
11 SASI_Hs01_00064595 predicted 371
12 SASI_Hs01_00064598 predicted 1008
13 SASI_Hs01_00064599 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351947 predicted 676
2 SASI_Rn02_00351948 predicted 731
3 SASI_Rn02_00351949 predicted 1388
4 SASI_Rn02_00351950 predicted 1295
5 SASI_Rn02_00351951 predicted 1179
6 SASI_Rn02_00351952 predicted 1829
7 SASI_Rn02_00351953 predicted 630
8 SASI_Rn02_00351954 predicted 1792
9 SASI_Rn02_00351955 predicted 1953
10 SASI_Rn02_00351956 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191651 predicted 681
2 SASI_Rn01_00191652 predicted 735
3 SASI_Rn01_00191653 predicted 1190
4 SASI_Rn01_00191654 predicted 2509
5 SASI_Rn01_00191655 predicted 635
6 SASI_Rn01_00191656 predicted 2464
7 SASI_Rn01_00191657 predicted 2001
8 SASI_Rn01_00191658 predicted 885
9 SASI_Rn01_00191659 predicted 908
10 SASI_Rn01_00191660 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327627 predicted 424
2 SASI_Mm02_00327628 predicted 543
3 SASI_Mm02_00327629 predicted 371
4 SASI_Mm02_00327630 predicted 1029
5 SASI_Mm02_00327631 predicted 395
6 SASI_Mm02_00327632 predicted 541
7 SASI_Mm02_00327633 predicted 868
8 SASI_Mm02_00327634 predicted 1262
9 SASI_Mm02_00327635 predicted 1103
10 SASI_Mm02_00327636 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251305 predicted 1054
2 SASI_Mm01_00251306 predicted 1164
3 SASI_Mm01_00251307 predicted 996
4 SASI_Mm01_00251308 predicted 1650
5 SASI_Mm01_00251309 predicted 1018
6 SASI_Mm01_00251310 predicted 331
7 SASI_Mm01_00251311 predicted 1486
8 SASI_Mm01_00251312 predicted 1889
9 SASI_Mm01_00251313 predicted 941
10 SASI_Mm01_00251314 predicted 1724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024537
VALIDATED
CARS2 MISSION shRNA Bacterial Glycerol Stock
cysteinyl-tRNA synthetase 2, mitochondrial (putative)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-368s1c1
Sequence:CCGGGATGGGTATTACAGATGTAGACTCGAGTCTACATCTGTAATACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-443s1c1
Sequence:CCGGCAGTCTTTATGAGGAAGACTTCTCGAGAAGTCTTCCTCATAAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-1633s1c1
Sequence:CCGGGCATCAACATCAAGGACAGAACTCGAGTTCTGTCCTTGATGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024537.1-622s1c1
Sequence:CCGGGAGGAGACAAGTATGGCAAATCTCGAGATTTGCCATACTTGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-355s1c1
Sequence:CCGGGCATAGTCATGGTGATGGGTACTCGAGTACCCATCACCATGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-1425s1c1
Sequence:CCGGCTGGCAAATCAACAGTACGTTCTCGAGAACGTACTGTTGATTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-841s1c1
Sequence:CCGGCAGGTGGGATAGATTTAGCTTCTCGAGAAGCTAAATCTATCCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-1651s1c1
Sequence:CCGGGAAGCAGTACAACATCCACGTCTCGAGACGTGGATGTTGTACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024537.1-951s1c1
Sequence:CCGGCACGCCAAAGGCAAAGAAGAACTCGAGTTCTTCTTTGCCTTTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-358s21c1
Sequence:CCGGTAGTCATGGTGATGGGTATTACTCGAGTAATACCCATCACCATGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-799s21c1
Sequence:CCGGCCATCGCTAGTATGGTATTTGCTCGAGCAAATACCATACTAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-864s21c1
Sequence:CCGGCCACATCATGAGAACGAAATTCTCGAGAATTTCGTTCTCATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-562s21c1
Sequence:CCGGTTGCTCGTGGGAACGCTTATTCTCGAGAATAAGCGTTCCCACGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-285s21c1
Sequence:CCGGCTTGGCCATGCTTGCTCATATCTCGAGATATGAGCAAGCATGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024537
VALIDATED
CARS2 MISSION shRNA shRNA Plasmid DNA
cysteinyl-tRNA synthetase 2, mitochondrial (putative)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-368s1c1
Sequence:CCGGGATGGGTATTACAGATGTAGACTCGAGTCTACATCTGTAATACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-443s1c1
Sequence:CCGGCAGTCTTTATGAGGAAGACTTCTCGAGAAGTCTTCCTCATAAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-1633s1c1
Sequence:CCGGGCATCAACATCAAGGACAGAACTCGAGTTCTGTCCTTGATGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024537.1-622s1c1
Sequence:CCGGGAGGAGACAAGTATGGCAAATCTCGAGATTTGCCATACTTGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-355s1c1
Sequence:CCGGGCATAGTCATGGTGATGGGTACTCGAGTACCCATCACCATGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-1425s1c1
Sequence:CCGGCTGGCAAATCAACAGTACGTTCTCGAGAACGTACTGTTGATTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-841s1c1
Sequence:CCGGCAGGTGGGATAGATTTAGCTTCTCGAGAAGCTAAATCTATCCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-1651s1c1
Sequence:CCGGGAAGCAGTACAACATCCACGTCTCGAGACGTGGATGTTGTACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024537.1-951s1c1
Sequence:CCGGCACGCCAAAGGCAAAGAAGAACTCGAGTTCTTCTTTGCCTTTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-358s21c1
Sequence:CCGGTAGTCATGGTGATGGGTATTACTCGAGTAATACCCATCACCATGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-799s21c1
Sequence:CCGGCCATCGCTAGTATGGTATTTGCTCGAGCAAATACCATACTAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-864s21c1
Sequence:CCGGCCACATCATGAGAACGAAATTCTCGAGAATTTCGTTCTCATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-562s21c1
Sequence:CCGGTTGCTCGTGGGAACGCTTATTCTCGAGAATAAGCGTTCCCACGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-285s21c1
Sequence:CCGGCTTGGCCATGCTTGCTCATATCTCGAGATATGAGCAAGCATGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024537
VALIDATED
CARS2 MISSION shRNA Lentiviral Transduction Particles
cysteinyl-tRNA synthetase 2, mitochondrial (putative)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-368s1c1
Sequence:CCGGGATGGGTATTACAGATGTAGACTCGAGTCTACATCTGTAATACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-443s1c1
Sequence:CCGGCAGTCTTTATGAGGAAGACTTCTCGAGAAGTCTTCCTCATAAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-1633s1c1
Sequence:CCGGGCATCAACATCAAGGACAGAACTCGAGTTCTGTCCTTGATGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024537.1-622s1c1
Sequence:CCGGGAGGAGACAAGTATGGCAAATCTCGAGATTTGCCATACTTGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-355s1c1
Sequence:CCGGGCATAGTCATGGTGATGGGTACTCGAGTACCCATCACCATGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-1425s1c1
Sequence:CCGGCTGGCAAATCAACAGTACGTTCTCGAGAACGTACTGTTGATTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024537.1-841s1c1
Sequence:CCGGCAGGTGGGATAGATTTAGCTTCTCGAGAAGCTAAATCTATCCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024537.1-1651s1c1
Sequence:CCGGGAAGCAGTACAACATCCACGTCTCGAGACGTGGATGTTGTACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024537.1-951s1c1
Sequence:CCGGCACGCCAAAGGCAAAGAAGAACTCGAGTTCTTCTTTGCCTTTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-358s21c1
Sequence:CCGGTAGTCATGGTGATGGGTATTACTCGAGTAATACCCATCACCATGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-799s21c1
Sequence:CCGGCCATCGCTAGTATGGTATTTGCTCGAGCAAATACCATACTAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-864s21c1
Sequence:CCGGCCACATCATGAGAACGAAATTCTCGAGAATTTCGTTCTCATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-562s21c1
Sequence:CCGGTTGCTCGTGGGAACGCTTATTCTCGAGAATAAGCGTTCCCACGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024537.1-285s21c1
Sequence:CCGGCTTGGCCATGCTTGCTCATATCTCGAGATATGAGCAAGCATGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024248
VALIDATED
CARS2 MISSION shRNA Bacterial Glycerol Stock
cysteinyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-1080s21c1
Sequence:CCGGTCTGCTTGCGTACCAACTATACTCGAGTATAGTTGGTACGCAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024248.1-320s21c1
Sequence:CCGGGCTTGCTCCTATGTTAGATTTCTCGAGAAATCTAACATAGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-1177s21c1
Sequence:CCGGGGATGCACGAGCCTACGTAAACTCGAGTTTACGTAGGCTCGTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-570s21c1
Sequence:CCGGCTTTCATCGAGGGCATCATTGCTCGAGCAATGATGCCCTCGATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024248.1-959s21c1
Sequence:CCGGTTCCTACATTCTGGTCATTTGCTCGAGCAAATGACCAGAATGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024248
VALIDATED
CARS2 MISSION shRNA shRNA Plasmid DNA
cysteinyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-1080s21c1
Sequence:CCGGTCTGCTTGCGTACCAACTATACTCGAGTATAGTTGGTACGCAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024248.1-320s21c1
Sequence:CCGGGCTTGCTCCTATGTTAGATTTCTCGAGAAATCTAACATAGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-1177s21c1
Sequence:CCGGGGATGCACGAGCCTACGTAAACTCGAGTTTACGTAGGCTCGTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-570s21c1
Sequence:CCGGCTTTCATCGAGGGCATCATTGCTCGAGCAATGATGCCCTCGATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024248.1-959s21c1
Sequence:CCGGTTCCTACATTCTGGTCATTTGCTCGAGCAAATGACCAGAATGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024248
VALIDATED
CARS2 MISSION shRNA Lentiviral Transduction Particles
cysteinyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-1080s21c1
Sequence:CCGGTCTGCTTGCGTACCAACTATACTCGAGTATAGTTGGTACGCAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024248.1-320s21c1
Sequence:CCGGGCTTGCTCCTATGTTAGATTTCTCGAGAAATCTAACATAGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-1177s21c1
Sequence:CCGGGGATGCACGAGCCTACGTAAACTCGAGTTTACGTAGGCTCGTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024248.1-570s21c1
Sequence:CCGGCTTTCATCGAGGGCATCATTGCTCGAGCAATGATGCCCTCGATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024248.1-959s21c1
Sequence:CCGGTTCCTACATTCTGGTCATTTGCTCGAGCAAATGACCAGAATGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks