EMAIL THIS PAGE TO A FRIEND

CARS

cysteinyl-tRNA synthetase

122 Gene Product Result for
Synonyms: CARS1 CYSRS MGC:11246
UniProtKB ID: P49589, Q53XI8, Q5HYE4, Q9HD24, Q9HD25
Gene ID:
Human(833) Summary: This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Mouse(27267) cysteinyl-tRNA synthetase
Rat(293638) cysteinyl-tRNA synthetase
naked mole-rat(101699578) cysteinyl-tRNA synthetase
domestic guinea pig(100733121) cysteinyl-tRNA synthetase
sheep(101119091) cysteinyl-tRNA synthetase
Zebrafish(368284) cysteinyl-tRNA synthetase
chicken(423086) cysteinyl-tRNA synthetase
cow(515715) cysteinyl-tRNA synthetase
domestic cat(101092144) cysteinyl-tRNA synthetase
dog(475998) cysteinyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014437 Rosetta Predictions human pricing
NM_001014438 Rosetta Predictions human pricing
NM_001751 Rosetta Predictions human pricing
NM_139273 Rosetta Predictions human pricing
NM_001106319 Rosetta Predictions rat pricing
NM_013742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175854 predicted 1900
2 SASI_Hs02_00306541 predicted 1064
3 SASI_Hs01_00175856 predicted 1686
4 SASI_Hs01_00175857 predicted 1740
5 SASI_Hs01_00175858 predicted 1516
6 SASI_Hs01_00175859 predicted 1249
7 SASI_Hs01_00175860 predicted 1972
8 SASI_Hs01_00175861 predicted 1021
9 SASI_Hs01_00175862 predicted 1004
10 SASI_Hs01_00175863 predicted 1815
11 SASI_Hs01_00175855 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247095 predicted 1943
2 SASI_Hs02_00306542 predicted 1114
3 SASI_Hs01_00247097 predicted 1735
4 SASI_Hs01_00247098 predicted 1779
5 SASI_Hs01_00247099 predicted 1567
6 SASI_Hs01_00247100 predicted 1304
7 SASI_Hs01_00247101 predicted 2017
8 SASI_Hs01_00247102 predicted 1071
9 SASI_Hs01_00247103 predicted 1057
10 SASI_Hs01_00247104 predicted 1867
11 SASI_Hs01_00247096 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110510 predicted 1651
2 SASI_Hs02_00332470 predicted 812
3 SASI_Hs01_00110512 predicted 1432
4 SASI_Hs01_00110513 predicted 1491
5 SASI_Hs01_00110514 predicted 1266
6 SASI_Hs01_00110515 predicted 1002
7 SASI_Hs01_00110516 predicted 1724
8 SASI_Hs01_00110517 predicted 771
9 SASI_Hs01_00110518 predicted 755
10 SASI_Hs01_00110519 predicted 1564
11 SASI_Hs01_00110511 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092557 predicted 1645
2 SASI_Hs02_00364255 predicted 811
3 SASI_Hs01_00092559 predicted 1441
4 SASI_Hs01_00092560 predicted 1484
5 SASI_Hs01_00092561 predicted 1273
6 SASI_Hs01_00092562 predicted 999
7 SASI_Hs01_00092563 predicted 1723
8 SASI_Hs01_00092564 predicted 774
9 SASI_Hs01_00092565 predicted 760
10 SASI_Hs01_00092566 predicted 1567
11 SASI_Hs01_00092558 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217798 predicted 1099
2 SASI_Rn02_00217799 predicted 314
3 SASI_Rn02_00217800 predicted 804
4 SASI_Rn02_00217801 predicted 840
5 SASI_Rn02_00217802 predicted 238
6 SASI_Rn02_00217803 predicted 888
7 SASI_Rn02_00217804 predicted 354
8 SASI_Rn02_00217805 predicted 860
9 SASI_Rn02_00217806 predicted 751
10 SASI_Rn02_00217807 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154619 predicted 394
2 SASI_Mm01_00154620 predicted 849
3 SASI_Mm01_00154622 predicted 1101
4 SASI_Mm01_00154623 predicted 520
5 SASI_Mm01_00154624 predicted 1045
6 SASI_Mm01_00154625 predicted 568
7 SASI_Mm01_00154626 predicted 456
8 SASI_Mm02_00322684 predicted 1049
9 SASI_Mm02_00322685 predicted 567
10 SASI_Mm02_00322686 predicted 957
11 SASI_Mm01_00154621 predicted 405
12 SASI_Mm01_00154627 predicted 709
13 SASI_Mm01_00154628 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013742
VALIDATED
CARS MISSION shRNA Bacterial Glycerol Stock
cysteinyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-2576s21c1
Sequence:CCGGTATGGACTAGGCCACAGCTACCTCGAGGTAGCTGTGGCCTAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013742.4-1046s21c1
Sequence:CCGGAGATTGTGGACAATGGTTATGCTCGAGCATAACCATTGTCCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-364s21c1
Sequence:CCGGTGCAGGCTCCGCCTCTATAATCTCGAGATTATAGAGGCGGAGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-2080s21c1
Sequence:CCGGCGAAAGATTGCCCGAGAGAAACTCGAGTTTCTCTCGGGCAATCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-1103s21c1
Sequence:CCGGCCAAGTTTGCTGCTAGTGAAACTCGAGTTTCACTAGCAGCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013742.2-2820s1c1
Sequence:CCGGCCGAGGAATTTCCCTCACATTCTCGAGAATGTGAGGGAAATTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-1118s1c1
Sequence:CCGGCCAAGTTTGCTGCTAGTGAAACTCGAGTTTCACTAGCAGCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-2095s1c1
Sequence:CCGGCGAAAGATTGCCCGAGAGAAACTCGAGTTTCTCTCGGGCAATCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-406s1c1
Sequence:CCGGACCCGGAACAAGGATGTATTTCTCGAGAAATACATCCTTGTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-409s1c1
Sequence:CCGGCGGAACAAGGATGTATTTATACTCGAGTATAAATACATCCTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013742
VALIDATED
CARS MISSION shRNA shRNA Plasmid DNA
cysteinyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-2576s21c1
Sequence:CCGGTATGGACTAGGCCACAGCTACCTCGAGGTAGCTGTGGCCTAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013742.4-1046s21c1
Sequence:CCGGAGATTGTGGACAATGGTTATGCTCGAGCATAACCATTGTCCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-364s21c1
Sequence:CCGGTGCAGGCTCCGCCTCTATAATCTCGAGATTATAGAGGCGGAGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-2080s21c1
Sequence:CCGGCGAAAGATTGCCCGAGAGAAACTCGAGTTTCTCTCGGGCAATCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-1103s21c1
Sequence:CCGGCCAAGTTTGCTGCTAGTGAAACTCGAGTTTCACTAGCAGCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013742.2-2820s1c1
Sequence:CCGGCCGAGGAATTTCCCTCACATTCTCGAGAATGTGAGGGAAATTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-1118s1c1
Sequence:CCGGCCAAGTTTGCTGCTAGTGAAACTCGAGTTTCACTAGCAGCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-2095s1c1
Sequence:CCGGCGAAAGATTGCCCGAGAGAAACTCGAGTTTCTCTCGGGCAATCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-406s1c1
Sequence:CCGGACCCGGAACAAGGATGTATTTCTCGAGAAATACATCCTTGTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-409s1c1
Sequence:CCGGCGGAACAAGGATGTATTTATACTCGAGTATAAATACATCCTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013742
VALIDATED
CARS MISSION shRNA Lentiviral Transduction Particles
cysteinyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-2576s21c1
Sequence:CCGGTATGGACTAGGCCACAGCTACCTCGAGGTAGCTGTGGCCTAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013742.4-1046s21c1
Sequence:CCGGAGATTGTGGACAATGGTTATGCTCGAGCATAACCATTGTCCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-364s21c1
Sequence:CCGGTGCAGGCTCCGCCTCTATAATCTCGAGATTATAGAGGCGGAGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-2080s21c1
Sequence:CCGGCGAAAGATTGCCCGAGAGAAACTCGAGTTTCTCTCGGGCAATCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013742.4-1103s21c1
Sequence:CCGGCCAAGTTTGCTGCTAGTGAAACTCGAGTTTCACTAGCAGCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013742.2-2820s1c1
Sequence:CCGGCCGAGGAATTTCCCTCACATTCTCGAGAATGTGAGGGAAATTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-1118s1c1
Sequence:CCGGCCAAGTTTGCTGCTAGTGAAACTCGAGTTTCACTAGCAGCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-2095s1c1
Sequence:CCGGCGAAAGATTGCCCGAGAGAAACTCGAGTTTCTCTCGGGCAATCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-406s1c1
Sequence:CCGGACCCGGAACAAGGATGTATTTCTCGAGAAATACATCCTTGTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013742.2-409s1c1
Sequence:CCGGCGGAACAAGGATGTATTTATACTCGAGTATAAATACATCCTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001751
VALIDATED
CARS MISSION shRNA Bacterial Glycerol Stock
cysteinyl-tRNA synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-1998s21c1
Sequence:CCGGGTAGACAGAAACACCTTATTACTCGAGTAATAAGGTGTTTCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-192s21c1
Sequence:CCGGGAAGTGTTCATACCTCAAGATCTCGAGATCTTGAGGTATGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-1724s21c1
Sequence:CCGGCCTCACCCATATGCTGAAGATCTCGAGATCTTCAGCATATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-682s21c1
Sequence:CCGGGCTGTGATGTCACTGACAATTCTCGAGAATTGTCAGTGACATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-2227s1c1
Sequence:CCGGGCAAGCCAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-678s1c1
Sequence:CCGGGCTGTGATGTCACTGACAATTCTCGAGAATTGTCAGTGACATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-188s1c1
Sequence:CCGGGAAGTGTTCATACCTCAAGATCTCGAGATCTTGAGGTATGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-1994s1c1
Sequence:CCGGGTAGACAGAAACACCTTATTACTCGAGTAATAAGGTGTTTCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-1720s1c1
Sequence:CCGGCCTCACCCATATGCTGAAGATCTCGAGATCTTCAGCATATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001751
VALIDATED
CARS MISSION shRNA shRNA Plasmid DNA
cysteinyl-tRNA synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-1998s21c1
Sequence:CCGGGTAGACAGAAACACCTTATTACTCGAGTAATAAGGTGTTTCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-192s21c1
Sequence:CCGGGAAGTGTTCATACCTCAAGATCTCGAGATCTTGAGGTATGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-1724s21c1
Sequence:CCGGCCTCACCCATATGCTGAAGATCTCGAGATCTTCAGCATATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-682s21c1
Sequence:CCGGGCTGTGATGTCACTGACAATTCTCGAGAATTGTCAGTGACATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-2227s1c1
Sequence:CCGGGCAAGCCAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-678s1c1
Sequence:CCGGGCTGTGATGTCACTGACAATTCTCGAGAATTGTCAGTGACATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-188s1c1
Sequence:CCGGGAAGTGTTCATACCTCAAGATCTCGAGATCTTGAGGTATGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-1994s1c1
Sequence:CCGGGTAGACAGAAACACCTTATTACTCGAGTAATAAGGTGTTTCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-1720s1c1
Sequence:CCGGCCTCACCCATATGCTGAAGATCTCGAGATCTTCAGCATATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001751
VALIDATED
CARS MISSION shRNA Lentiviral Transduction Particles
cysteinyl-tRNA synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-1998s21c1
Sequence:CCGGGTAGACAGAAACACCTTATTACTCGAGTAATAAGGTGTTTCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-192s21c1
Sequence:CCGGGAAGTGTTCATACCTCAAGATCTCGAGATCTTGAGGTATGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-1724s21c1
Sequence:CCGGCCTCACCCATATGCTGAAGATCTCGAGATCTTCAGCATATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001751.4-682s21c1
Sequence:CCGGGCTGTGATGTCACTGACAATTCTCGAGAATTGTCAGTGACATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-2227s1c1
Sequence:CCGGGCAAGCCAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-678s1c1
Sequence:CCGGGCTGTGATGTCACTGACAATTCTCGAGAATTGTCAGTGACATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-188s1c1
Sequence:CCGGGAAGTGTTCATACCTCAAGATCTCGAGATCTTGAGGTATGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-1994s1c1
Sequence:CCGGGTAGACAGAAACACCTTATTACTCGAGTAATAAGGTGTTTCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001751.3-1720s1c1
Sequence:CCGGCCTCACCCATATGCTGAAGATCTCGAGATCTTCAGCATATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks