EMAIL THIS PAGE TO A FRIEND

CARTPT

CART prepropeptide

93 Gene Product Result for
Synonyms: CART
UniProtKB ID: Q16568, Q6FG92
Gene ID:
Human(9607) Summary: This gene encodes a secreted protein which is processed by prohormone/proprotein convertases to produce smaller, biologically active peptides. Expression of the transcript for this gene is regulated by certain drugs such as cocaine, and the encoded protein is thought to be involved in the regulation of appetite and stress. Mutations in this gene are associated with susceptibility to obesity.[provided by RefSeq, Nov 2009]
Mouse(27220) CART prepropeptide
Rat(29131) CART prepropeptide
chicken(100858488) CART prepropeptide
cow(493726) CART prepropeptide
domestic cat(101091085) CART prepropeptide
dog(610236) CART prepropeptide
naked mole-rat(101710231) CART prepropeptide
domestic guinea pig(100736061) CART prepropeptide
sheep(101109912) CART prepropeptide
sheep(100294655) CART prepropeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011701 MISSION® esiRNA esiRNA targeting human CARTPT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004291 Rosetta Predictions human pricing
NM_017110 Rosetta Predictions rat pricing
NM_001081493 Rosetta Predictions mouse pricing
NM_013732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171513 predicted 674
2 SASI_Hs01_00171514 predicted 236
3 SASI_Hs01_00171515 predicted 648
4 SASI_Hs01_00171516 predicted 658
5 SASI_Hs01_00171517 predicted 552
6 SASI_Hs01_00171518 predicted 675
7 SASI_Hs01_00171519 predicted 665
8 SASI_Hs02_00337295 predicted 404
9 SASI_Hs01_00171520 predicted 280
10 SASI_Hs01_00171521 predicted 664
11 SASI_Hs01_00171522 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045210 predicted 237
2 SASI_Rn01_00045211 predicted 565
3 SASI_Rn01_00045212 predicted 421
4 SASI_Rn01_00045214 predicted 575
5 SASI_Rn01_00045215 predicted 472
6 SASI_Rn01_00045216 predicted 591
7 SASI_Rn01_00045217 predicted 374
8 SASI_Rn01_00045218 predicted 594
9 SASI_Rn01_00045219 predicted 505
10 SASI_Rn02_00261343 predicted 408
11 SASI_Rn01_00045213 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298620 predicted 407
2 SASI_Mm02_00298621 predicted 404
3 SASI_Mm02_00298622 predicted 541
4 SASI_Mm02_00298623 predicted 578
5 SASI_Mm02_00298624 predicted 588
6 SASI_Mm02_00298625 predicted 514
7 SASI_Mm02_00298626 predicted 499
8 SASI_Mm02_00298627 predicted 470
9 SASI_Mm02_00298628 predicted 463
10 SASI_Mm02_00298629 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322666 predicted 449
2 SASI_Mm02_00322667 predicted 447
3 SASI_Mm02_00322668 predicted 580
4 SASI_Mm02_00322669 predicted 618
5 SASI_Mm02_00322670 predicted 624
6 SASI_Mm02_00322671 predicted 541
7 SASI_Mm02_00322672 predicted 503
8 SASI_Mm02_00322673 predicted 511
9 SASI_Mm02_00322674 predicted 609
10 SASI_Mm02_00322675 predicted 598
11 SASI_Mm01_00181500 predicted 225
12 SASI_Mm01_00181501 predicted 251
13 SASI_Mm01_00181502 predicted 210
14 SASI_Mm01_00181503 predicted 241
15 SASI_Mm01_00181504 predicted 226
16 SASI_Mm01_00181505 predicted 297
17 SASI_Mm01_00181506 predicted 217
18 SASI_Mm01_00181507 predicted 243
19 SASI_Mm01_00181508 predicted 332
20 SASI_Mm01_00181509 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004291
CARTPT MISSION shRNA Bacterial Glycerol Stock
CART prepropeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004291.2-676s21c1
Sequence:CCGGTTGATACGTGTGTGAAGTATTCTCGAGAATACTTCACACACGTATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004291.2-553s21c1
Sequence:CCGGTTGGCTTAAGCAACAGATAAACTCGAGTTTATCTGTTGCTTAAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004291.2-273s21c1
Sequence:CCGGACGAGAAGGAGCTGATCGAAGCTCGAGCTTCGATCAGCTCCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004291.1-205s1c1
Sequence:CCGGGAAGCTCAAGAGTAAACGTGTCTCGAGACACGTTTACTCTTGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-327s1c1
Sequence:CCGGCCCGAGGAACCTCCTGCAATTCTCGAGAATTGCAGGAGGTTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-227s1c1
Sequence:CCGGCCCATCTATGAGAAGAAGTATCTCGAGATACTTCTTCTCATAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-348s1c1
Sequence:CCGGCCTTCCTCCTGAAGTGCTTATCTCGAGATAAGCACTTCAGGAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-72s1c1
Sequence:CCGGTGATGCTACCTCTGTTGGGTACTCGAGTACCCAACAGAGGTAGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-211s1c1
Sequence:CCGGCAAGAGTAAACGTGTTCCCATCTCGAGATGGGAACACGTTTACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004291
CARTPT MISSION shRNA shRNA Plasmid DNA
CART prepropeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004291.2-676s21c1
Sequence:CCGGTTGATACGTGTGTGAAGTATTCTCGAGAATACTTCACACACGTATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004291.2-553s21c1
Sequence:CCGGTTGGCTTAAGCAACAGATAAACTCGAGTTTATCTGTTGCTTAAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004291.2-273s21c1
Sequence:CCGGACGAGAAGGAGCTGATCGAAGCTCGAGCTTCGATCAGCTCCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004291.1-205s1c1
Sequence:CCGGGAAGCTCAAGAGTAAACGTGTCTCGAGACACGTTTACTCTTGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-327s1c1
Sequence:CCGGCCCGAGGAACCTCCTGCAATTCTCGAGAATTGCAGGAGGTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-227s1c1
Sequence:CCGGCCCATCTATGAGAAGAAGTATCTCGAGATACTTCTTCTCATAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-348s1c1
Sequence:CCGGCCTTCCTCCTGAAGTGCTTATCTCGAGATAAGCACTTCAGGAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-72s1c1
Sequence:CCGGTGATGCTACCTCTGTTGGGTACTCGAGTACCCAACAGAGGTAGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-211s1c1
Sequence:CCGGCAAGAGTAAACGTGTTCCCATCTCGAGATGGGAACACGTTTACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004291
CARTPT MISSION shRNA Lentiviral Transduction Particles
CART prepropeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004291.2-676s21c1
Sequence:CCGGTTGATACGTGTGTGAAGTATTCTCGAGAATACTTCACACACGTATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004291.2-553s21c1
Sequence:CCGGTTGGCTTAAGCAACAGATAAACTCGAGTTTATCTGTTGCTTAAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004291.2-273s21c1
Sequence:CCGGACGAGAAGGAGCTGATCGAAGCTCGAGCTTCGATCAGCTCCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004291.1-205s1c1
Sequence:CCGGGAAGCTCAAGAGTAAACGTGTCTCGAGACACGTTTACTCTTGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-327s1c1
Sequence:CCGGCCCGAGGAACCTCCTGCAATTCTCGAGAATTGCAGGAGGTTCCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-227s1c1
Sequence:CCGGCCCATCTATGAGAAGAAGTATCTCGAGATACTTCTTCTCATAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-348s1c1
Sequence:CCGGCCTTCCTCCTGAAGTGCTTATCTCGAGATAAGCACTTCAGGAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-72s1c1
Sequence:CCGGTGATGCTACCTCTGTTGGGTACTCGAGTACCCAACAGAGGTAGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004291.1-211s1c1
Sequence:CCGGCAAGAGTAAACGTGTTCCCATCTCGAGATGGGAACACGTTTACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013732
CARTPT MISSION shRNA Bacterial Glycerol Stock
CART prepropeptide
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-367s1c1
Sequence:CCGGCTGCAATTCTTTCCTCTTGAACTCGAGTTCAAGAGGAAAGAATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-232s1c1
Sequence:CCGGGAAGCTCAAGAGTAAACGCATCTCGAGATGCGTTTACTCTTGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-354s1c1
Sequence:CCGGCCCGAGGAACTTCCTGCAATTCTCGAGAATTGCAGGAAGTTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013732.3-419s1c1
Sequence:CCGGCGGTTCCCATATTCCCTCTTTCTCGAGAAAGAGGGAATATGGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013732
CARTPT MISSION shRNA shRNA Plasmid DNA
CART prepropeptide
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-367s1c1
Sequence:CCGGCTGCAATTCTTTCCTCTTGAACTCGAGTTCAAGAGGAAAGAATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-232s1c1
Sequence:CCGGGAAGCTCAAGAGTAAACGCATCTCGAGATGCGTTTACTCTTGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-354s1c1
Sequence:CCGGCCCGAGGAACTTCCTGCAATTCTCGAGAATTGCAGGAAGTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013732.3-419s1c1
Sequence:CCGGCGGTTCCCATATTCCCTCTTTCTCGAGAAAGAGGGAATATGGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013732
CARTPT MISSION shRNA Lentiviral Transduction Particles
CART prepropeptide
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-367s1c1
Sequence:CCGGCTGCAATTCTTTCCTCTTGAACTCGAGTTCAAGAGGAAAGAATTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-232s1c1
Sequence:CCGGGAAGCTCAAGAGTAAACGCATCTCGAGATGCGTTTACTCTTGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013732.3-354s1c1
Sequence:CCGGCCCGAGGAACTTCCTGCAATTCTCGAGAATTGCAGGAAGTTCCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013732.3-419s1c1
Sequence:CCGGCGGTTCCCATATTCCCTCTTTCTCGAGAAAGAGGGAATATGGGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)