EMAIL THIS PAGE TO A FRIEND

CASC10

cancer susceptibility candidate 10

39 Gene Product Result for
Synonyms: C10orf114 bA418C1.3
Species: Human CASC10(399726)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010911 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010911 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218099 predicted 885
2 SASI_Hs01_00218100 predicted 924
3 SASI_Hs01_00218101 predicted 1032
4 SASI_Hs01_00218102 predicted 791
5 SASI_Hs01_00218103 predicted 852
6 SASI_Hs01_00218105 predicted 920
7 SASI_Hs01_00218106 predicted 889
8 SASI_Hs01_00218107 predicted 853
9 SASI_Hs02_00305895 predicted 889
10 SASI_Hs01_00218108 predicted 928
11 SASI_Hs01_00218104 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010911
CASC10 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-860s21c1
Sequence:CCGGCGATTTCGACAGGCGAGATTGCTCGAGCAATCTCGCCTGTCGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-845s21c1
Sequence:CCGGCGGATGCGCAGCTAGCGATTTCTCGAGAAATCGCTAGCTGCGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-805s21c1
Sequence:CCGGTTGATCCCTTCACCCTACCTCCTCGAGGAGGTAGGGTGAAGGGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010911.2-928s21c1
Sequence:CCGGGGAACGACCAGAATGACATTTCTCGAGAAATGTCATTCTGGTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010911.2-942s21c1
Sequence:CCGGGACATTTCTTTAAGCCTAAATCTCGAGATTTAGGCTTAAAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010911.1-869s1c1
Sequence:CCGGGCGAGTATATGAGGTTGAGTACTCGAGTACTCAACCTCATATACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010911.1-1411s1c1
Sequence:CCGGCCATCCGCAGTAAATTCCCTTCTCGAGAAGGGAATTTACTGCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010911.1-772s1c1
Sequence:CCGGCTGCTATCTGCTTGATCCCTTCTCGAGAAGGGATCAAGCAGATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168814    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010911.1-1416s1c1
Sequence:CCGGCGCAGTAAATTCCCTTCCTTTCTCGAGAAAGGAAGGGAATTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010911
CASC10 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-860s21c1
Sequence:CCGGCGATTTCGACAGGCGAGATTGCTCGAGCAATCTCGCCTGTCGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-845s21c1
Sequence:CCGGCGGATGCGCAGCTAGCGATTTCTCGAGAAATCGCTAGCTGCGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-805s21c1
Sequence:CCGGTTGATCCCTTCACCCTACCTCCTCGAGGAGGTAGGGTGAAGGGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010911.2-928s21c1
Sequence:CCGGGGAACGACCAGAATGACATTTCTCGAGAAATGTCATTCTGGTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010911.2-942s21c1
Sequence:CCGGGACATTTCTTTAAGCCTAAATCTCGAGATTTAGGCTTAAAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010911.1-869s1c1
Sequence:CCGGGCGAGTATATGAGGTTGAGTACTCGAGTACTCAACCTCATATACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010911.1-1411s1c1
Sequence:CCGGCCATCCGCAGTAAATTCCCTTCTCGAGAAGGGAATTTACTGCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010911.1-772s1c1
Sequence:CCGGCTGCTATCTGCTTGATCCCTTCTCGAGAAGGGATCAAGCAGATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168814    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010911.1-1416s1c1
Sequence:CCGGCGCAGTAAATTCCCTTCCTTTCTCGAGAAAGGAAGGGAATTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010911
CASC10 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-860s21c1
Sequence:CCGGCGATTTCGACAGGCGAGATTGCTCGAGCAATCTCGCCTGTCGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-845s21c1
Sequence:CCGGCGGATGCGCAGCTAGCGATTTCTCGAGAAATCGCTAGCTGCGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010911.2-805s21c1
Sequence:CCGGTTGATCCCTTCACCCTACCTCCTCGAGGAGGTAGGGTGAAGGGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010911.2-928s21c1
Sequence:CCGGGGAACGACCAGAATGACATTTCTCGAGAAATGTCATTCTGGTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010911.2-942s21c1
Sequence:CCGGGACATTTCTTTAAGCCTAAATCTCGAGATTTAGGCTTAAAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010911.1-869s1c1
Sequence:CCGGGCGAGTATATGAGGTTGAGTACTCGAGTACTCAACCTCATATACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010911.1-1411s1c1
Sequence:CCGGCCATCCGCAGTAAATTCCCTTCTCGAGAAGGGAATTTACTGCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010911.1-772s1c1
Sequence:CCGGCTGCTATCTGCTTGATCCCTTCTCGAGAAGGGATCAAGCAGATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168814    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010911.1-1416s1c1
Sequence:CCGGCGCAGTAAATTCCCTTCCTTTCTCGAGAAAGGAAGGGAATTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks