EMAIL THIS PAGE TO A FRIEND

CASC1

cancer susceptibility candidate 1

109 Gene Product Result for
Synonyms: LAS1 PPP1R54
Gene ID:
Mouse(320662) cancer susceptibility candidate 1
Rat(297720) cancer susceptibility candidate 1
Zebrafish(566485) cancer susceptibility candidate 1
chicken(418206) cancer susceptibility candidate 1
dog(486630) cancer susceptibility candidate 1
cow(526444) cancer susceptibility candidate 1
domestic cat(101099729) cancer susceptibility candidate 1
sheep(101114856) cancer susceptibility candidate 1
domestic guinea pig(100722724) cancer susceptibility candidate 1
naked mole-rat(101719575) cancer susceptibility candidate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093671 MISSION® esiRNA esiRNA human CASC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082972 Rosetta Predictions human pricing
NM_001082973 Rosetta Predictions human pricing
NM_018272 Rosetta Predictions human pricing
NM_001106627 Rosetta Predictions rat pricing
NM_177222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316822 predicted 1918
2 SASI_Hs02_00316823 predicted 1767
3 SASI_Hs02_00316824 predicted 579
4 SASI_Hs02_00316825 predicted 1533
5 SASI_Hs02_00316826 predicted 1884
6 SASI_Hs02_00316827 predicted 1440
7 SASI_Hs02_00316828 predicted 1797
8 SASI_Hs02_00316829 predicted 1049
9 SASI_Hs02_00316830 predicted 979
10 SASI_Hs02_00316831 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316832 predicted 1709
2 SASI_Hs02_00316833 predicted 1560
3 SASI_Hs02_00316834 predicted 374
4 SASI_Hs02_00316835 predicted 1329
5 SASI_Hs02_00316836 predicted 1679
6 SASI_Hs02_00316837 predicted 1229
7 SASI_Hs02_00316838 predicted 1593
8 SASI_Hs02_00316839 predicted 841
9 SASI_Hs02_00316840 predicted 762
10 SASI_Hs02_00316841 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351642 predicted 1728
2 SASI_Hs01_00136280 predicted 1584
3 SASI_Hs02_00351643 predicted 393
4 SASI_Hs01_00136282 predicted 1342
5 SASI_Hs01_00136286 predicted 1699
6 SASI_Hs01_00136287 predicted 1243
7 SASI_Hs01_00136288 predicted 1605
8 SASI_Hs02_00351644 predicted 863
9 SASI_Hs01_00136289 predicted 788
10 SASI_Hs02_00351645 predicted 763
11 SASI_Hs01_00136281 predicted 2037
12 SASI_Hs01_00136283 predicted 1843
13 SASI_Hs01_00136284 predicted 2021
14 SASI_Hs01_00136285 predicted 1983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220808 predicted 1708
2 SASI_Rn02_00220809 predicted 1715
3 SASI_Rn02_00220810 predicted 1537
4 SASI_Rn02_00220811 predicted 1593
5 SASI_Rn02_00220812 predicted 1511
6 SASI_Rn02_00220813 predicted 1191
7 SASI_Rn02_00220814 predicted 1945
8 SASI_Rn02_00220815 predicted 789
9 SASI_Rn02_00220816 predicted 802
10 SASI_Rn02_00220817 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176177 predicted 1627
2 SASI_Mm01_00176178 predicted 654
3 SASI_Mm01_00176179 predicted 501
4 SASI_Mm01_00176180 predicted 1217
5 SASI_Mm01_00176181 predicted 1258
6 SASI_Mm01_00176182 predicted 1085
7 SASI_Mm01_00176183 predicted 1665
8 SASI_Mm01_00176184 predicted 598
9 SASI_Mm01_00176185 predicted 1976
10 SASI_Mm02_00347251 predicted 1905
11 SASI_Mm01_00176186 predicted 1542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018272
CASC1 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-466s1c1
Sequence:CCGGGCCCAAGAAATGAACACGTTTCTCGAGAAACGTGTTCATTTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018272.2-2329s1c1
Sequence:CCGGGCATGGTGAAAGACAGGTATTCTCGAGAATACCTGTCTTTCACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-930s1c1
Sequence:CCGGCCCTGTTTCAACACCATCAAACTCGAGTTTGATGGTGTTGAAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-2290s1c1
Sequence:CCGGCCTCCACTTACAAACTGTATTCTCGAGAATACAGTTTGTAAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-1610s1c1
Sequence:CCGGCCTTGATTCAAGATGCTCATACTCGAGTATGAGCATCTTGAATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018272.3-1930s21c1
Sequence:CCGGGAGCAAGTGGAACCTACTATGCTCGAGCATAGTAGGTTCCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018272.3-1053s21c1
Sequence:CCGGAGGAGGAACAAGGTGATATTGCTCGAGCAATATCACCTTGTTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018272
CASC1 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-466s1c1
Sequence:CCGGGCCCAAGAAATGAACACGTTTCTCGAGAAACGTGTTCATTTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018272.2-2329s1c1
Sequence:CCGGGCATGGTGAAAGACAGGTATTCTCGAGAATACCTGTCTTTCACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-930s1c1
Sequence:CCGGCCCTGTTTCAACACCATCAAACTCGAGTTTGATGGTGTTGAAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-2290s1c1
Sequence:CCGGCCTCCACTTACAAACTGTATTCTCGAGAATACAGTTTGTAAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-1610s1c1
Sequence:CCGGCCTTGATTCAAGATGCTCATACTCGAGTATGAGCATCTTGAATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018272.3-1930s21c1
Sequence:CCGGGAGCAAGTGGAACCTACTATGCTCGAGCATAGTAGGTTCCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018272.3-1053s21c1
Sequence:CCGGAGGAGGAACAAGGTGATATTGCTCGAGCAATATCACCTTGTTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018272
CASC1 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-466s1c1
Sequence:CCGGGCCCAAGAAATGAACACGTTTCTCGAGAAACGTGTTCATTTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018272.2-2329s1c1
Sequence:CCGGGCATGGTGAAAGACAGGTATTCTCGAGAATACCTGTCTTTCACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-930s1c1
Sequence:CCGGCCCTGTTTCAACACCATCAAACTCGAGTTTGATGGTGTTGAAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-2290s1c1
Sequence:CCGGCCTCCACTTACAAACTGTATTCTCGAGAATACAGTTTGTAAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018272.2-1610s1c1
Sequence:CCGGCCTTGATTCAAGATGCTCATACTCGAGTATGAGCATCTTGAATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018272.3-1930s21c1
Sequence:CCGGGAGCAAGTGGAACCTACTATGCTCGAGCATAGTAGGTTCCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018272.3-1053s21c1
Sequence:CCGGAGGAGGAACAAGGTGATATTGCTCGAGCAATATCACCTTGTTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177222
CASC1 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177222.3-2228s1c1
Sequence:CCGGGTTCATCGACTCAGTGTGCTACTCGAGTAGCACACTGAGTCGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177222.3-1602s1c1
Sequence:CCGGCCTGTGACCTTGATTCAGGATCTCGAGATCCTGAATCAAGGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-1913s21c1
Sequence:CCGGGTTGAAGGCCTATCGGCAAATCTCGAGATTTGCCGATAGGCCTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-594s21c1
Sequence:CCGGCTGCAGCATCAAGGGTCAATTCTCGAGAATTGACCCTTGATGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-354s21c1
Sequence:CCGGGAGAAACAGAAGCGGGAAATTCTCGAGAATTTCCCGCTTCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-552s21c1
Sequence:CCGGTTACTGGAAACTCCGACATATCTCGAGATATGTCGGAGTTTCCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-1578s21c1
Sequence:CCGGACCTTCAGTATGGATACTTTGCTCGAGCAAAGTATCCATACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177222
CASC1 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177222.3-2228s1c1
Sequence:CCGGGTTCATCGACTCAGTGTGCTACTCGAGTAGCACACTGAGTCGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177222.3-1602s1c1
Sequence:CCGGCCTGTGACCTTGATTCAGGATCTCGAGATCCTGAATCAAGGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-1913s21c1
Sequence:CCGGGTTGAAGGCCTATCGGCAAATCTCGAGATTTGCCGATAGGCCTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-594s21c1
Sequence:CCGGCTGCAGCATCAAGGGTCAATTCTCGAGAATTGACCCTTGATGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-354s21c1
Sequence:CCGGGAGAAACAGAAGCGGGAAATTCTCGAGAATTTCCCGCTTCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-552s21c1
Sequence:CCGGTTACTGGAAACTCCGACATATCTCGAGATATGTCGGAGTTTCCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-1578s21c1
Sequence:CCGGACCTTCAGTATGGATACTTTGCTCGAGCAAAGTATCCATACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177222
CASC1 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177222.3-2228s1c1
Sequence:CCGGGTTCATCGACTCAGTGTGCTACTCGAGTAGCACACTGAGTCGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177222.3-1602s1c1
Sequence:CCGGCCTGTGACCTTGATTCAGGATCTCGAGATCCTGAATCAAGGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-1913s21c1
Sequence:CCGGGTTGAAGGCCTATCGGCAAATCTCGAGATTTGCCGATAGGCCTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-594s21c1
Sequence:CCGGCTGCAGCATCAAGGGTCAATTCTCGAGAATTGACCCTTGATGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-354s21c1
Sequence:CCGGGAGAAACAGAAGCGGGAAATTCTCGAGAATTTCCCGCTTCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-552s21c1
Sequence:CCGGTTACTGGAAACTCCGACATATCTCGAGATATGTCGGAGTTTCCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177222.3-1578s21c1
Sequence:CCGGACCTTCAGTATGGATACTTTGCTCGAGCAAAGTATCCATACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks