EMAIL THIS PAGE TO A FRIEND

CASC2

cancer susceptibility candidate 2 (non-protein coding)

1 Gene Product Result for
Synonyms: C10orf5
Species: Human CASC2(255082)
UniProtKB ID: Q6XLA1, D3DRC5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201377 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133721 MISSION® esiRNA esiRNA human CASC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201377
CASC2 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 2 (non-protein coding)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-444s1c1
Sequence:CCGGCGCATGAAGCATTTCGGATCTCTCGAGAGATCCGAAATGCTTCATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-506s1c1
Sequence:CCGGCCATCCATGTGTCATTACAATCTCGAGATTGTAATGACACATGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-465s1c1
Sequence:CCGGGCTTTAAGACTGAGGCAGACTCTCGAGAGTCTGCCTCAGTCTTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201377.1-328s1c1
Sequence:CCGGGTGCAAATCAACATCAACACACTCGAGTGTGTTGATGTTGATTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-342s1c1
Sequence:CCGGCAACACAGAACTGCTGAAGAACTCGAGTTCTTCAGCAGTTCTGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-502s1c1
Sequence:CCGGCCGACCATCCATGTGTCATTACTCGAGTAATGACACATGGATGGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201377
CASC2 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 2 (non-protein coding)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-444s1c1
Sequence:CCGGCGCATGAAGCATTTCGGATCTCTCGAGAGATCCGAAATGCTTCATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-506s1c1
Sequence:CCGGCCATCCATGTGTCATTACAATCTCGAGATTGTAATGACACATGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-465s1c1
Sequence:CCGGGCTTTAAGACTGAGGCAGACTCTCGAGAGTCTGCCTCAGTCTTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201377.1-328s1c1
Sequence:CCGGGTGCAAATCAACATCAACACACTCGAGTGTGTTGATGTTGATTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-342s1c1
Sequence:CCGGCAACACAGAACTGCTGAAGAACTCGAGTTCTTCAGCAGTTCTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-502s1c1
Sequence:CCGGCCGACCATCCATGTGTCATTACTCGAGTAATGACACATGGATGGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201377
CASC2 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 2 (non-protein coding)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-444s1c1
Sequence:CCGGCGCATGAAGCATTTCGGATCTCTCGAGAGATCCGAAATGCTTCATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-506s1c1
Sequence:CCGGCCATCCATGTGTCATTACAATCTCGAGATTGTAATGACACATGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-465s1c1
Sequence:CCGGGCTTTAAGACTGAGGCAGACTCTCGAGAGTCTGCCTCAGTCTTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201377.1-328s1c1
Sequence:CCGGGTGCAAATCAACATCAACACACTCGAGTGTGTTGATGTTGATTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-342s1c1
Sequence:CCGGCAACACAGAACTGCTGAAGAACTCGAGTTCTTCAGCAGTTCTGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201377.1-502s1c1
Sequence:CCGGCCGACCATCCATGTGTCATTACTCGAGTAATGACACATGGATGGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)