EMAIL THIS PAGE TO A FRIEND

CASC3

cancer susceptibility candidate 3

187 Gene Product Result for
Synonyms: BTZ MLN51
UniProtKB ID: O15234, A8K8R0
Gene ID:
Human(22794) Summary: The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
Mouse(192160) cancer susceptibility candidate 3
Rat(259170) cancer susceptibility candidate 3
Zebrafish(403025) cancer susceptibility candidate 3
cow(531673) cancer susceptibility candidate 3
domestic cat(101095867) cancer susceptibility candidate 3
dog(480528) cancer susceptibility candidate 3
chicken(426135) cancer susceptibility candidate 3
naked mole-rat(101725973) cancer susceptibility candidate 3
domestic guinea pig(100727378) cancer susceptibility candidate 3
sheep(101107033) cancer susceptibility candidate 3
Domestic Rabbit(100358381) cancer susceptibility candidate 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007359 Rosetta Predictions human pricing
NM_147144 Rosetta Predictions rat pricing
NM_138660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226699 predicted 1958
2 SASI_Hs01_00226700 predicted 1857
3 SASI_Hs01_00226701 predicted 1043
4 SASI_Hs02_00343463 predicted 1803
5 SASI_Hs01_00226702 predicted 2468
6 SASI_Hs02_00343464 predicted 858
7 SASI_Hs01_00226703 predicted 1486
8 SASI_Hs02_00343465 predicted 1853
9 SASI_Hs01_00226706 predicted 1758
10 SASI_Hs01_00226707 predicted 2190
11 SASI_Hs01_00226704 predicted 640
12 SASI_Hs01_00226705 predicted 1005
13 SASI_Hs01_00226708 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102702 predicted 868
2 SASI_Rn01_00102703 predicted 1648
3 SASI_Rn01_00102704 predicted 230
4 SASI_Rn01_00102705 predicted 1447
5 SASI_Rn01_00102706 predicted 1959
6 SASI_Rn02_00268854 predicted 792
7 SASI_Rn01_00102708 predicted 1601
8 SASI_Rn01_00102709 predicted 687
9 SASI_Rn01_00102710 predicted 1618
10 SASI_Rn02_00268855 predicted 1183
11 SASI_Rn01_00102701 predicted 860
12 SASI_Rn01_00102707 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197200 predicted 453
2 SASI_Mm01_00197201 predicted 1698
3 SASI_Mm01_00197202 predicted 1424
4 SASI_Mm01_00197203 predicted 862
5 SASI_Mm01_00197204 predicted 750
6 SASI_Mm01_00197205 predicted 277
7 SASI_Mm01_00197206 predicted 413
8 SASI_Mm01_00197207 predicted 1749
9 SASI_Mm01_00197209 predicted 1564
10 SASI_Mm02_00339719 predicted 1654
11 SASI_Mm01_00197208 predicted 1476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007359
VALIDATED
CASC3 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1425s1c1
Sequence:CCGGCCCATTGAGAAGAAATCCTATCTCGAGATAGGATTTCTTCTCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1743s1c1
Sequence:CCGGCCTCAGTTTAACCGGATGGAACTCGAGTTCCATCCGGTTAAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-759s1c1
Sequence:CCGGCGGAAGAATCCAGCATACATACTCGAGTATGTATGCTGGATTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1102s1c1
Sequence:CCGGCCCTACCACCAAGGACATTTACTCGAGTAAATGTCCTTGGTGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007359.3-585s1c1
Sequence:CCGGGAAGCTAATGATGCTGTTAATCTCGAGATTAACAGCATCATTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-821s21c1
Sequence:CCGGCGGAAGAATCCAGCATACATACTCGAGTATGTATGCTGGATTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-1805s21c1
Sequence:CCGGCCTCAGTTTAACCGGATGGAACTCGAGTTCCATCCGGTTAAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-1164s21c1
Sequence:CCGGCCCTACCACCAAGGACATTTACTCGAGTAAATGTCCTTGGTGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-647s21c1
Sequence:CCGGGAAGCTAATGATGCTGTTAATCTCGAGATTAACAGCATCATTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007359
VALIDATED
CASC3 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1425s1c1
Sequence:CCGGCCCATTGAGAAGAAATCCTATCTCGAGATAGGATTTCTTCTCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1743s1c1
Sequence:CCGGCCTCAGTTTAACCGGATGGAACTCGAGTTCCATCCGGTTAAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-759s1c1
Sequence:CCGGCGGAAGAATCCAGCATACATACTCGAGTATGTATGCTGGATTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1102s1c1
Sequence:CCGGCCCTACCACCAAGGACATTTACTCGAGTAAATGTCCTTGGTGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007359.3-585s1c1
Sequence:CCGGGAAGCTAATGATGCTGTTAATCTCGAGATTAACAGCATCATTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-821s21c1
Sequence:CCGGCGGAAGAATCCAGCATACATACTCGAGTATGTATGCTGGATTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-1805s21c1
Sequence:CCGGCCTCAGTTTAACCGGATGGAACTCGAGTTCCATCCGGTTAAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-1164s21c1
Sequence:CCGGCCCTACCACCAAGGACATTTACTCGAGTAAATGTCCTTGGTGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-647s21c1
Sequence:CCGGGAAGCTAATGATGCTGTTAATCTCGAGATTAACAGCATCATTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007359
VALIDATED
CASC3 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1425s1c1
Sequence:CCGGCCCATTGAGAAGAAATCCTATCTCGAGATAGGATTTCTTCTCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1743s1c1
Sequence:CCGGCCTCAGTTTAACCGGATGGAACTCGAGTTCCATCCGGTTAAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-759s1c1
Sequence:CCGGCGGAAGAATCCAGCATACATACTCGAGTATGTATGCTGGATTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007359.3-1102s1c1
Sequence:CCGGCCCTACCACCAAGGACATTTACTCGAGTAAATGTCCTTGGTGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007359.3-585s1c1
Sequence:CCGGGAAGCTAATGATGCTGTTAATCTCGAGATTAACAGCATCATTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-821s21c1
Sequence:CCGGCGGAAGAATCCAGCATACATACTCGAGTATGTATGCTGGATTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-1805s21c1
Sequence:CCGGCCTCAGTTTAACCGGATGGAACTCGAGTTCCATCCGGTTAAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-1164s21c1
Sequence:CCGGCCCTACCACCAAGGACATTTACTCGAGTAAATGTCCTTGGTGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007359.4-647s21c1
Sequence:CCGGGAAGCTAATGATGCTGTTAATCTCGAGATTAACAGCATCATTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138660
VALIDATED
CASC3 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138660.1-632s1c1
Sequence:CCGGCTGATTCCTCTGCGAAAGAAACTCGAGTTTCTTTCGCAGAGGAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138660.1-2914s1c1
Sequence:CCGGCCTTGTGATTGGTCTTTATTACTCGAGTAATAAAGACCAATCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138660.1-1669s1c1
Sequence:CCGGGCAGAACAAAGTTGGAGTCCACTCGAGTGGACTCCAACTTTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138660.2-309s21c1
Sequence:CCGGGATGCTGTTCTTTCCGATTATCTCGAGATAATCGGAAAGAACAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138660.2-817s21c1
Sequence:CCGGGAATCCGGAAACCTCGATTTGCTCGAGCAAATCGAGGTTTCCGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138660.2-1431s21c1
Sequence:CCGGCAAGATGTGGCGCAGCTAAATCTCGAGATTTAGCTGCGCCACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138660.2-1755s21c1
Sequence:CCGGATGATCGTACAGCCGGAAATGCTCGAGCATTTCCGGCTGTACGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138660.2-3208s21c1
Sequence:CCGGGGTAACTATACCTAGACTTAACTCGAGTTAAGTCTAGGTATAGTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138660
VALIDATED
CASC3 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138660.1-632s1c1
Sequence:CCGGCTGATTCCTCTGCGAAAGAAACTCGAGTTTCTTTCGCAGAGGAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138660.1-2914s1c1
Sequence:CCGGCCTTGTGATTGGTCTTTATTACTCGAGTAATAAAGACCAATCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138660.1-1669s1c1
Sequence:CCGGGCAGAACAAAGTTGGAGTCCACTCGAGTGGACTCCAACTTTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138660.2-309s21c1
Sequence:CCGGGATGCTGTTCTTTCCGATTATCTCGAGATAATCGGAAAGAACAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138660.2-817s21c1
Sequence:CCGGGAATCCGGAAACCTCGATTTGCTCGAGCAAATCGAGGTTTCCGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138660.2-1431s21c1
Sequence:CCGGCAAGATGTGGCGCAGCTAAATCTCGAGATTTAGCTGCGCCACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138660.2-1755s21c1
Sequence:CCGGATGATCGTACAGCCGGAAATGCTCGAGCATTTCCGGCTGTACGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138660.2-3208s21c1
Sequence:CCGGGGTAACTATACCTAGACTTAACTCGAGTTAAGTCTAGGTATAGTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138660
VALIDATED
CASC3 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138660.1-632s1c1
Sequence:CCGGCTGATTCCTCTGCGAAAGAAACTCGAGTTTCTTTCGCAGAGGAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138660.1-2914s1c1
Sequence:CCGGCCTTGTGATTGGTCTTTATTACTCGAGTAATAAAGACCAATCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138660.1-1669s1c1
Sequence:CCGGGCAGAACAAAGTTGGAGTCCACTCGAGTGGACTCCAACTTTGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138660.2-309s21c1
Sequence:CCGGGATGCTGTTCTTTCCGATTATCTCGAGATAATCGGAAAGAACAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138660.2-817s21c1
Sequence:CCGGGAATCCGGAAACCTCGATTTGCTCGAGCAAATCGAGGTTTCCGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138660.2-1431s21c1
Sequence:CCGGCAAGATGTGGCGCAGCTAAATCTCGAGATTTAGCTGCGCCACATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138660.2-1755s21c1
Sequence:CCGGATGATCGTACAGCCGGAAATGCTCGAGCATTTCCGGCTGTACGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138660.2-3208s21c1
Sequence:CCGGGGTAACTATACCTAGACTTAACTCGAGTTAAGTCTAGGTATAGTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)