EMAIL THIS PAGE TO A FRIEND

CASC4

cancer susceptibility candidate 4

212 Gene Product Result for
Synonyms: H63
UniProtKB ID: Q6P4E1, G5E934, Q6UY45, Q96EM1
Gene ID:
Human(113201) Summary: The increased expression level of this gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. Alternatively spliced variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Dec 2010]
Mouse(319996) cancer susceptibility candidate 4
Rat(362204) cancer susceptibility candidate 4
domestic guinea pig(100726415) cancer susceptibility candidate 4
Zebrafish(555654) cancer susceptibility candidate 4
cow(540780) cancer susceptibility candidate 4
domestic cat(101095343) cancer susceptibility candidate 4
dog(478283) cancer susceptibility candidate 4
chicken(415575) cancer susceptibility candidate 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138423 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138423 Rosetta Predictions human pricing
NM_177974 Rosetta Predictions human pricing
XM_001076981 Rosetta Predictions rat pricing
XM_001077001 Rosetta Predictions rat pricing
XM_001077018 Rosetta Predictions rat pricing
XM_001077041 Rosetta Predictions rat pricing
XM_342506 Rosetta Predictions rat pricing
NM_177054 Rosetta Predictions mouse pricing
NM_199038 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146582 predicted 1754
2 SASI_Hs01_00146583 predicted 907
3 SASI_Hs01_00146584 predicted 921
4 SASI_Hs01_00146585 predicted 884
5 SASI_Hs01_00146587 predicted 1743
6 SASI_Hs01_00146588 predicted 1760
7 SASI_Hs01_00146589 predicted 659
8 SASI_Hs01_00146590 predicted 804
9 SASI_Hs01_00146591 predicted 492
10 SASI_Hs02_00363575 predicted 641
11 SASI_Hs01_00146586 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028621 predicted 1591
2 SASI_Hs01_00028622 predicted 909
3 SASI_Hs01_00028623 predicted 922
4 SASI_Hs01_00028624 predicted 882
5 SASI_Hs01_00028626 predicted 1579
6 SASI_Hs01_00028627 predicted 1585
7 SASI_Hs01_00028628 predicted 660
8 SASI_Hs01_00028629 predicted 803
9 SASI_Hs01_00028630 predicted 486
10 SASI_Hs02_00369449 predicted 640
11 SASI_Hs01_00028625 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355302 predicted 827
2 SASI_Rn02_00355303 predicted 825
3 SASI_Rn02_00355304 predicted 1144
4 SASI_Rn02_00355305 predicted 1193
5 SASI_Rn02_00355306 predicted 1239
6 SASI_Rn02_00355307 predicted 578
7 SASI_Rn02_00355308 predicted 1256
8 SASI_Rn02_00355309 predicted 699
9 SASI_Rn02_00355310 predicted 748
10 SASI_Rn02_00355311 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355382 predicted 829
2 SASI_Rn02_00355383 predicted 1086
3 SASI_Rn02_00355384 predicted 1144
4 SASI_Rn02_00355385 predicted 1041
5 SASI_Rn02_00355386 predicted 585
6 SASI_Rn02_00355387 predicted 1155
7 SASI_Rn02_00355388 predicted 694
8 SASI_Rn02_00355389 predicted 1257
9 SASI_Rn02_00355390 predicted 747
10 SASI_Rn02_00355391 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355449 predicted 827
2 SASI_Rn02_00355450 predicted 831
3 SASI_Rn02_00355451 predicted 1143
4 SASI_Rn02_00355452 predicted 1189
5 SASI_Rn02_00355453 predicted 1238
6 SASI_Rn02_00355454 predicted 583
7 SASI_Rn02_00355455 predicted 1260
8 SASI_Rn02_00355456 predicted 698
9 SASI_Rn02_00355457 predicted 1352
10 SASI_Rn02_00355458 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355529 predicted 822
2 SASI_Rn02_00355530 predicted 1146
3 SASI_Rn02_00355531 predicted 1190
4 SASI_Rn02_00355532 predicted 1234
5 SASI_Rn02_00355533 predicted 584
6 SASI_Rn02_00355534 predicted 1250
7 SASI_Rn02_00355535 predicted 699
8 SASI_Rn02_00355536 predicted 1356
9 SASI_Rn02_00355537 predicted 749
10 SASI_Rn02_00355538 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394389 predicted 661
2 SASI_Rn02_00394390 predicted 984
3 SASI_Rn02_00394391 predicted 1024
4 SASI_Rn02_00394392 predicted 1081
5 SASI_Rn02_00394393 predicted 425
6 SASI_Rn02_00394394 predicted 1097
7 SASI_Rn02_00394395 predicted 538
8 SASI_Rn02_00394396 predicted 588
9 SASI_Rn02_00394397 predicted 506
10 SASI_Rn02_00394398 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168955 predicted 814
2 SASI_Mm01_00168956 predicted 687
3 SASI_Mm01_00168957 predicted 811
4 SASI_Mm01_00168959 predicted 613
5 SASI_Mm01_00168960 predicted 595
6 SASI_Mm01_00168961 predicted 738
7 SASI_Mm01_00168962 predicted 483
8 SASI_Mm01_00168963 predicted 732
9 SASI_Mm01_00168964 predicted 693
10 SASI_Mm02_00347017 predicted 589
11 SASI_Mm01_00168958 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112642 predicted 818
2 SASI_Mm01_00112643 predicted 692
3 SASI_Mm01_00112644 predicted 811
4 SASI_Mm01_00112646 predicted 614
5 SASI_Mm01_00112647 predicted 589
6 SASI_Mm01_00112648 predicted 738
7 SASI_Mm01_00112649 predicted 486
8 SASI_Mm01_00112650 predicted 733
9 SASI_Mm01_00112651 predicted 687
10 SASI_Mm02_00351323 predicted 587
11 SASI_Mm01_00112645 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177054
CASC4 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-502s1c1
Sequence:CCGGCAGCTTCAAGACTACAGGAAACTCGAGTTTCCTGTAGTCTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-478s1c1
Sequence:CCGGCAGGAGTTTCTTCGACAGGAACTCGAGTTCCTGTCGAAGAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-926s1c1
Sequence:CCGGCAAATCCTCTTCAGCACATAACTCGAGTTATGTGCTGAAGAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177054.3-1654s1c1
Sequence:CCGGGCAGGTTATATGCTGCACATACTCGAGTATGTGCAGCATATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177054
CASC4 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-502s1c1
Sequence:CCGGCAGCTTCAAGACTACAGGAAACTCGAGTTTCCTGTAGTCTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-478s1c1
Sequence:CCGGCAGGAGTTTCTTCGACAGGAACTCGAGTTCCTGTCGAAGAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-926s1c1
Sequence:CCGGCAAATCCTCTTCAGCACATAACTCGAGTTATGTGCTGAAGAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177054.3-1654s1c1
Sequence:CCGGGCAGGTTATATGCTGCACATACTCGAGTATGTGCAGCATATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177054
CASC4 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-502s1c1
Sequence:CCGGCAGCTTCAAGACTACAGGAAACTCGAGTTTCCTGTAGTCTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-478s1c1
Sequence:CCGGCAGGAGTTTCTTCGACAGGAACTCGAGTTCCTGTCGAAGAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177054.3-926s1c1
Sequence:CCGGCAAATCCTCTTCAGCACATAACTCGAGTTATGTGCTGAAGAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177054.3-1654s1c1
Sequence:CCGGGCAGGTTATATGCTGCACATACTCGAGTATGTGCAGCATATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138423
VALIDATED
CASC4 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-527s1c1
Sequence:CCGGGCACAAGAAACAGATCGACCACTCGAGTGGTCGATCTGTTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138423.2-1417s1c1
Sequence:CCGGGCTCTAAACTGGCGGATTATACTCGAGTATAATCCGCCAGTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-1893s1c1
Sequence:CCGGGCCGACTTATTTCCACAAATACTCGAGTATTTGTGGAAATAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-1613s1c1
Sequence:CCGGCCTAAAGGAATGCTTCAGAAACTCGAGTTTCTGAAGCATTCCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-699s1c1
Sequence:CCGGCGTCAGGAATTTCTTCGACAACTCGAGTTGTCGAAGAAATTCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-1539s1c1
Sequence:CCGGGATGATGAAGAACGAGAGCTTCTCGAGAAGCTCTCGTTCTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-530s1c1
Sequence:CCGGCAAGAAACAGATCGACCAGAACTCGAGTTCTGGTCGATCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-980s1c1
Sequence:CCGGGAATGAAGAACCCTCAAGCAACTCGAGTTGCTTGAGGGTTCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138423
VALIDATED
CASC4 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-527s1c1
Sequence:CCGGGCACAAGAAACAGATCGACCACTCGAGTGGTCGATCTGTTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138423.2-1417s1c1
Sequence:CCGGGCTCTAAACTGGCGGATTATACTCGAGTATAATCCGCCAGTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-1893s1c1
Sequence:CCGGGCCGACTTATTTCCACAAATACTCGAGTATTTGTGGAAATAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-1613s1c1
Sequence:CCGGCCTAAAGGAATGCTTCAGAAACTCGAGTTTCTGAAGCATTCCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-699s1c1
Sequence:CCGGCGTCAGGAATTTCTTCGACAACTCGAGTTGTCGAAGAAATTCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-1539s1c1
Sequence:CCGGGATGATGAAGAACGAGAGCTTCTCGAGAAGCTCTCGTTCTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-530s1c1
Sequence:CCGGCAAGAAACAGATCGACCAGAACTCGAGTTCTGGTCGATCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-980s1c1
Sequence:CCGGGAATGAAGAACCCTCAAGCAACTCGAGTTGCTTGAGGGTTCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138423
VALIDATED
CASC4 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-527s1c1
Sequence:CCGGGCACAAGAAACAGATCGACCACTCGAGTGGTCGATCTGTTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138423.2-1417s1c1
Sequence:CCGGGCTCTAAACTGGCGGATTATACTCGAGTATAATCCGCCAGTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-1893s1c1
Sequence:CCGGGCCGACTTATTTCCACAAATACTCGAGTATTTGTGGAAATAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-1613s1c1
Sequence:CCGGCCTAAAGGAATGCTTCAGAAACTCGAGTTTCTGAAGCATTCCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-699s1c1
Sequence:CCGGCGTCAGGAATTTCTTCGACAACTCGAGTTGTCGAAGAAATTCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-1539s1c1
Sequence:CCGGGATGATGAAGAACGAGAGCTTCTCGAGAAGCTCTCGTTCTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138423.2-530s1c1
Sequence:CCGGCAAGAAACAGATCGACCAGAACTCGAGTTCTGGTCGATCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138423.2-980s1c1
Sequence:CCGGGAATGAAGAACCCTCAAGCAACTCGAGTTGCTTGAGGGTTCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks