EMAIL THIS PAGE TO A FRIEND

CASC5

cancer susceptibility candidate 5

168 Gene Product Result for
Synonyms: AF15Q14 CT29 D40 KNL1 PPP1R55 Spc7 hKNL-1 hSpc105
UniProtKB ID: Q8NG31, Q8NHE1, Q8WXA6, Q9HCK2, Q9NR92
Gene ID:
Human(57082) Summary: The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
Mouse(76464) cancer susceptibility candidate 5
Rat(311327) cancer susceptibility candidate 5
Zebrafish(327226) cancer susceptibility candidate 5
chicken(423007) cancer susceptibility candidate 5
cow(787969) cancer susceptibility candidate 5
Horse(100071354) cancer susceptibility candidate 5
domestic cat(101086398) cancer susceptibility candidate 5
dog(478260) cancer susceptibility candidate 5
naked mole-rat(101715049) cancer susceptibility candidate 5
domestic guinea pig(100730663) cancer susceptibility candidate 5
sheep(101114616) cancer susceptibility candidate 5
Domestic Rabbit(100346129) cancer susceptibility candidate 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144508 Rosetta Predictions human pricing
NM_170589 Rosetta Predictions human pricing
XM_001080790 Rosetta Predictions rat pricing
XM_230465 Rosetta Predictions rat pricing
NM_029617 Rosetta Predictions mouse pricing
XM_001005065 Rosetta Predictions mouse pricing
XM_001005067 Rosetta Predictions mouse pricing
XM_001005069 Rosetta Predictions mouse pricing
XM_001005071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247046 predicted 5982
2 SASI_Hs01_00247047 predicted 3071
3 SASI_Hs01_00247049 predicted 2516
4 SASI_Hs02_00364329 predicted 3253
5 SASI_Hs01_00247050 predicted 3418
6 SASI_Hs01_00247051 predicted 2465
7 SASI_Hs01_00247052 predicted 2920
8 SASI_Hs02_00364330 predicted 4797
9 SASI_Hs01_00247053 predicted 2173
10 SASI_Hs01_00247054 predicted 2288
11 SASI_Hs01_00247048 predicted 6375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099481 predicted 6060
2 SASI_Hs01_00099482 predicted 3150
3 SASI_Hs01_00099483 predicted 2599
4 SASI_Hs02_00367544 predicted 3327
5 SASI_Hs01_00099485 predicted 3488
6 SASI_Hs01_00099486 predicted 2545
7 SASI_Hs01_00099489 predicted 2989
8 SASI_Hs02_00367545 predicted 4878
9 SASI_Hs01_00099488 predicted 2254
10 SASI_Hs02_00367546 predicted 2370
11 SASI_Hs01_00099484 predicted 6674
12 SASI_Hs01_00099487 predicted 1502
13 SASI_Hs01_00099490 predicted 5902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369372 predicted 5602
2 SASI_Rn02_00369373 predicted 3313
3 SASI_Rn02_00369374 predicted 1267
4 SASI_Rn02_00369375 predicted 3605
5 SASI_Rn02_00369376 predicted 5096
6 SASI_Rn02_00369377 predicted 4668
7 SASI_Rn02_00369378 predicted 1299
8 SASI_Rn02_00369379 predicted 5252
9 SASI_Rn02_00369380 predicted 4521
10 SASI_Rn02_00369381 predicted 5643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386240 predicted 3473
2 SASI_Rn02_00386241 predicted 3318
3 SASI_Rn02_00386242 predicted 3814
4 SASI_Rn02_00386243 predicted 2338
5 SASI_Rn02_00386244 predicted 1311
6 SASI_Rn02_00386245 predicted 1260
7 SASI_Rn02_00386246 predicted 1905
8 SASI_Rn02_00386247 predicted 1041
9 SASI_Rn02_00386248 predicted 3607
10 SASI_Rn02_00386249 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335599 predicted 5947
2 SASI_Mm02_00335600 predicted 5610
3 SASI_Mm02_00335601 predicted 905
4 SASI_Mm02_00335602 predicted 5839
5 SASI_Mm02_00335603 predicted 3360
6 SASI_Mm02_00335604 predicted 1014
7 SASI_Mm02_00335605 predicted 2029
8 SASI_Mm02_00335606 predicted 3757
9 SASI_Mm02_00335607 predicted 2312
10 SASI_Mm02_00335608 predicted 4615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213634 predicted 4726
2 SASI_Mm01_00213635 predicted 2773
3 SASI_Mm01_00213636 predicted 1967
4 SASI_Mm01_00213637 predicted 4434
5 SASI_Mm01_00213638 predicted 3116
6 SASI_Mm01_00213639 predicted 3324
7 SASI_Mm01_00213640 predicted 4531
8 SASI_Mm01_00213641 predicted 2016
9 SASI_Mm01_00213642 predicted 1773
10 SASI_Mm01_00213643 predicted 2293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264118 predicted 5174
2 SASI_Mm01_00264119 predicted 3220
3 SASI_Mm01_00264120 predicted 2424
4 SASI_Mm01_00264121 predicted 4881
5 SASI_Mm01_00264122 predicted 3562
6 SASI_Mm01_00264123 predicted 3772
7 SASI_Mm01_00264124 predicted 4985
8 SASI_Mm01_00264125 predicted 2463
9 SASI_Mm01_00264126 predicted 2216
10 SASI_Mm01_00264127 predicted 2740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217005 predicted 2804
2 SASI_Mm01_00217006 predicted 2000
3 SASI_Mm01_00217007 predicted 3844
4 SASI_Mm01_00217008 predicted 4463
5 SASI_Mm01_00217009 predicted 3145
6 SASI_Mm01_00217010 predicted 3348
7 SASI_Mm01_00217011 predicted 4555
8 SASI_Mm01_00217012 predicted 2032
9 SASI_Mm01_00217013 predicted 1792
10 SASI_Mm01_00217014 predicted 2312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228399 predicted 3227
2 SASI_Mm01_00228400 predicted 2421
3 SASI_Mm01_00228401 predicted 4268
4 SASI_Mm01_00228402 predicted 4880
5 SASI_Mm01_00228403 predicted 3561
6 SASI_Mm01_00228404 predicted 3771
7 SASI_Mm01_00228405 predicted 4981
8 SASI_Mm01_00228406 predicted 2458
9 SASI_Mm01_00228407 predicted 2218
10 SASI_Mm01_00228408 predicted 2739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144508
CASC5 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-5217s1c1
Sequence:CCGGGCAAAGATTCAGGCATTGGATCTCGAGATCCAATGCCTGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-3411s1c1
Sequence:CCGGCCCAGAGTTGTATGGTGGAAACTCGAGTTTCCACCATACAACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6721s1c1
Sequence:CCGGCCAGCATCAGTTACCCAAGATCTCGAGATCTTGGGTAACTGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-3955s1c1
Sequence:CCGGGCAAGTTGAAAGCTGTCAGTTCTCGAGAACTGACAGCTTTCAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6398s1c1
Sequence:CCGGGCTCAAATAGACTTTATGCAACTCGAGTTGCATAAAGTCTATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-5885s1c1
Sequence:CCGGCGACCCAAGATACAGATTTATCTCGAGATAAATCTGTATCTTGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-666s1c1
Sequence:CCGGCCACCAAGATAGATACCACATCTCGAGATGTGGTATCTATCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-4328s1c1
Sequence:CCGGCCACGAAATCTATTGGCTAATCTCGAGATTAGCCAATAGATTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-1055s1c1
Sequence:CCGGCGGGAATCTAAAGGTAATGATCTCGAGATCATTACCTTTAGATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6924s1c1
Sequence:CCGGCCTATTATCCATCTGTACCATCTCGAGATGGTACAGATGGATAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-542s1c1
Sequence:CCGGCGTGAAAGGAAACATGCAAATCTCGAGATTTGCATGTTTCCTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144508
CASC5 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-5217s1c1
Sequence:CCGGGCAAAGATTCAGGCATTGGATCTCGAGATCCAATGCCTGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-3411s1c1
Sequence:CCGGCCCAGAGTTGTATGGTGGAAACTCGAGTTTCCACCATACAACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6721s1c1
Sequence:CCGGCCAGCATCAGTTACCCAAGATCTCGAGATCTTGGGTAACTGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-3955s1c1
Sequence:CCGGGCAAGTTGAAAGCTGTCAGTTCTCGAGAACTGACAGCTTTCAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6398s1c1
Sequence:CCGGGCTCAAATAGACTTTATGCAACTCGAGTTGCATAAAGTCTATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-5885s1c1
Sequence:CCGGCGACCCAAGATACAGATTTATCTCGAGATAAATCTGTATCTTGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-666s1c1
Sequence:CCGGCCACCAAGATAGATACCACATCTCGAGATGTGGTATCTATCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-4328s1c1
Sequence:CCGGCCACGAAATCTATTGGCTAATCTCGAGATTAGCCAATAGATTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-1055s1c1
Sequence:CCGGCGGGAATCTAAAGGTAATGATCTCGAGATCATTACCTTTAGATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6924s1c1
Sequence:CCGGCCTATTATCCATCTGTACCATCTCGAGATGGTACAGATGGATAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-542s1c1
Sequence:CCGGCGTGAAAGGAAACATGCAAATCTCGAGATTTGCATGTTTCCTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144508
CASC5 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-5217s1c1
Sequence:CCGGGCAAAGATTCAGGCATTGGATCTCGAGATCCAATGCCTGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-3411s1c1
Sequence:CCGGCCCAGAGTTGTATGGTGGAAACTCGAGTTTCCACCATACAACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6721s1c1
Sequence:CCGGCCAGCATCAGTTACCCAAGATCTCGAGATCTTGGGTAACTGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-3955s1c1
Sequence:CCGGGCAAGTTGAAAGCTGTCAGTTCTCGAGAACTGACAGCTTTCAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6398s1c1
Sequence:CCGGGCTCAAATAGACTTTATGCAACTCGAGTTGCATAAAGTCTATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-5885s1c1
Sequence:CCGGCGACCCAAGATACAGATTTATCTCGAGATAAATCTGTATCTTGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-666s1c1
Sequence:CCGGCCACCAAGATAGATACCACATCTCGAGATGTGGTATCTATCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-4328s1c1
Sequence:CCGGCCACGAAATCTATTGGCTAATCTCGAGATTAGCCAATAGATTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144508.1-1055s1c1
Sequence:CCGGCGGGAATCTAAAGGTAATGATCTCGAGATCATTACCTTTAGATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-6924s1c1
Sequence:CCGGCCTATTATCCATCTGTACCATCTCGAGATGGTACAGATGGATAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144508.1-542s1c1
Sequence:CCGGCGTGAAAGGAAACATGCAAATCTCGAGATTTGCATGTTTCCTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029617
VALIDATED
CASC5 MISSION shRNA Bacterial Glycerol Stock
cancer susceptibility candidate 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-6182s21c1
Sequence:CCGGCTTGGAGAGGAGATCGAATTTCTCGAGAAATTCGATCTCCTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-1522s21c1
Sequence:CCGGTCACACCGTTGCAATAGATAACTCGAGTTATCTATTGCAACGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-6311s21c1
Sequence:CCGGTTGTCTCCCTCGGCCCATTATCTCGAGATAATGGGCCGAGGGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-5371s21c1
Sequence:CCGGTAAACTATTGGCGGATGTAAACTCGAGTTTACATCCGCCAATAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029617.2-5052s21c1
Sequence:CCGGATGTCAGCACACAGCGTAATACTCGAGTATTACGCTGTGTGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029617
VALIDATED
CASC5 MISSION shRNA shRNA Plasmid DNA
cancer susceptibility candidate 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-6182s21c1
Sequence:CCGGCTTGGAGAGGAGATCGAATTTCTCGAGAAATTCGATCTCCTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-1522s21c1
Sequence:CCGGTCACACCGTTGCAATAGATAACTCGAGTTATCTATTGCAACGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-6311s21c1
Sequence:CCGGTTGTCTCCCTCGGCCCATTATCTCGAGATAATGGGCCGAGGGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-5371s21c1
Sequence:CCGGTAAACTATTGGCGGATGTAAACTCGAGTTTACATCCGCCAATAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029617.2-5052s21c1
Sequence:CCGGATGTCAGCACACAGCGTAATACTCGAGTATTACGCTGTGTGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029617
VALIDATED
CASC5 MISSION shRNA Lentiviral Transduction Particles
cancer susceptibility candidate 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-6182s21c1
Sequence:CCGGCTTGGAGAGGAGATCGAATTTCTCGAGAAATTCGATCTCCTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-1522s21c1
Sequence:CCGGTCACACCGTTGCAATAGATAACTCGAGTTATCTATTGCAACGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-6311s21c1
Sequence:CCGGTTGTCTCCCTCGGCCCATTATCTCGAGATAATGGGCCGAGGGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029617.2-5371s21c1
Sequence:CCGGTAAACTATTGGCGGATGTAAACTCGAGTTTACATCCGCCAATAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029617.2-5052s21c1
Sequence:CCGGATGTCAGCACACAGCGTAATACTCGAGTATTACGCTGTGTGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks