EMAIL THIS PAGE TO A FRIEND

CASD1

CAS1 domain containing 1

88 Gene Product Result for
Synonyms: C7orf12 NBLA04196
Gene ID:
Mouse(213819) CAS1 domain containing 1
Zebrafish(692268) CAS1 domain containing 1
chicken(420565) CAS1 domain containing 1
dog(475232) CAS1 domain containing 1
Horse(100062437) CAS1 domain containing 1
cow(532541) CAS1 domain containing 1
domestic cat(101094006) CAS1 domain containing 1
sheep(101114863) CAS1 domain containing 1
domestic guinea pig(100719716) CAS1 domain containing 1
naked mole-rat(101722739) CAS1 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022900 Rosetta Predictions human pricing
NM_145398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210664 predicted 497
2 SASI_Hs01_00210665 predicted 826
3 SASI_Hs01_00210666 predicted 632
4 SASI_Hs02_00356187 predicted 1043
5 SASI_Hs01_00210668 predicted 1005
6 SASI_Hs01_00210669 predicted 2435
7 SASI_Hs01_00210670 predicted 643
8 SASI_Hs01_00210671 predicted 1221
9 SASI_Hs02_00356188 predicted 2404
10 SASI_Hs02_00356189 predicted 666
11 SASI_Hs01_00210663 predicted 876
12 SASI_Hs01_00210667 predicted 1052
13 SASI_Hs01_00210672 predicted 2275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057147 predicted 517
2 SASI_Mm01_00057148 predicted 1628
3 SASI_Mm01_00057150 predicted 375
4 SASI_Mm01_00057151 predicted 667
5 SASI_Mm01_00057152 predicted 2164
6 SASI_Mm01_00057153 predicted 2334
7 SASI_Mm01_00057155 predicted 701
8 SASI_Mm02_00340727 predicted 541
9 SASI_Mm01_00057156 predicted 1564
10 SASI_Mm02_00340728 predicted 2090
11 SASI_Mm01_00057149 predicted 934
12 SASI_Mm01_00057154 predicted 2434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022900
VALIDATED
CASD1 MISSION shRNA Bacterial Glycerol Stock
CAS1 domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-2497s21c1
Sequence:CCGGATGATCTTGCACAGATTATTACTCGAGTAATAATCTGTGCAAGATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-2919s21c1
Sequence:CCGGATGAAGGCAGGGAAATGATTACTCGAGTAATCATTTCCCTGCCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-1610s21c1
Sequence:CCGGAGTTCTGGTTGCTGCATATTTCTCGAGAAATATGCAGCAACCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-3022s21c1
Sequence:CCGGAGACTGTCTGCACCTGTATTCCTCGAGGAATACAGGTGCAGACAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-1744s21c1
Sequence:CCGGTAGTAATGGATCGACCTTATCCTCGAGGATAAGGTCGATCCATTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-2081s21c1
Sequence:CCGGGGCTTTGCAGAAGCGTCAAATCTCGAGATTTGACGCTTCTGCAAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-857s21c1
Sequence:CCGGTCCTGTTTATGAAGATCTATTCTCGAGAATAGATCTTCATAAACAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-2687s21c1
Sequence:CCGGCATCTATCTGGAGATATAAATCTCGAGATTTATATCTCCAGATAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-1844s1c1
Sequence:CCGGCGGAAATTGTTTCTGGCATTTCTCGAGAAATGCCAGAAACAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-342s1c1
Sequence:CCGGCGAGGCAATGATTCGTGTGAACTCGAGTTCACACGAATCATTGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022900.3-2067s1c1
Sequence:CCGGGCCTTGCAGAAGCGTCAAATACTCGAGTATTTGACGCTTCTGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-1519s1c1
Sequence:CCGGGCTGGATGCAACTTGTGATTTCTCGAGAAATCACAAGTTGCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022900.3-2287s1c1
Sequence:CCGGCCCGTTCAGTTTACAGTTCATCTCGAGATGAACTGTAAACTGAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022900
VALIDATED
CASD1 MISSION shRNA shRNA Plasmid DNA
CAS1 domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-2497s21c1
Sequence:CCGGATGATCTTGCACAGATTATTACTCGAGTAATAATCTGTGCAAGATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-2919s21c1
Sequence:CCGGATGAAGGCAGGGAAATGATTACTCGAGTAATCATTTCCCTGCCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-1610s21c1
Sequence:CCGGAGTTCTGGTTGCTGCATATTTCTCGAGAAATATGCAGCAACCAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-3022s21c1
Sequence:CCGGAGACTGTCTGCACCTGTATTCCTCGAGGAATACAGGTGCAGACAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-1744s21c1
Sequence:CCGGTAGTAATGGATCGACCTTATCCTCGAGGATAAGGTCGATCCATTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-2081s21c1
Sequence:CCGGGGCTTTGCAGAAGCGTCAAATCTCGAGATTTGACGCTTCTGCAAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-857s21c1
Sequence:CCGGTCCTGTTTATGAAGATCTATTCTCGAGAATAGATCTTCATAAACAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-2687s21c1
Sequence:CCGGCATCTATCTGGAGATATAAATCTCGAGATTTATATCTCCAGATAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-1844s1c1
Sequence:CCGGCGGAAATTGTTTCTGGCATTTCTCGAGAAATGCCAGAAACAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-342s1c1
Sequence:CCGGCGAGGCAATGATTCGTGTGAACTCGAGTTCACACGAATCATTGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022900.3-2067s1c1
Sequence:CCGGGCCTTGCAGAAGCGTCAAATACTCGAGTATTTGACGCTTCTGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-1519s1c1
Sequence:CCGGGCTGGATGCAACTTGTGATTTCTCGAGAAATCACAAGTTGCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022900.3-2287s1c1
Sequence:CCGGCCCGTTCAGTTTACAGTTCATCTCGAGATGAACTGTAAACTGAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022900
VALIDATED
CASD1 MISSION shRNA Lentiviral Transduction Particles
CAS1 domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-2497s21c1
Sequence:CCGGATGATCTTGCACAGATTATTACTCGAGTAATAATCTGTGCAAGATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-2919s21c1
Sequence:CCGGATGAAGGCAGGGAAATGATTACTCGAGTAATCATTTCCCTGCCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-1610s21c1
Sequence:CCGGAGTTCTGGTTGCTGCATATTTCTCGAGAAATATGCAGCAACCAGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-3022s21c1
Sequence:CCGGAGACTGTCTGCACCTGTATTCCTCGAGGAATACAGGTGCAGACAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-1744s21c1
Sequence:CCGGTAGTAATGGATCGACCTTATCCTCGAGGATAAGGTCGATCCATTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-2081s21c1
Sequence:CCGGGGCTTTGCAGAAGCGTCAAATCTCGAGATTTGACGCTTCTGCAAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022900.4-857s21c1
Sequence:CCGGTCCTGTTTATGAAGATCTATTCTCGAGAATAGATCTTCATAAACAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022900.4-2687s21c1
Sequence:CCGGCATCTATCTGGAGATATAAATCTCGAGATTTATATCTCCAGATAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-1844s1c1
Sequence:CCGGCGGAAATTGTTTCTGGCATTTCTCGAGAAATGCCAGAAACAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-342s1c1
Sequence:CCGGCGAGGCAATGATTCGTGTGAACTCGAGTTCACACGAATCATTGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022900.3-2067s1c1
Sequence:CCGGGCCTTGCAGAAGCGTCAAATACTCGAGTATTTGACGCTTCTGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022900.3-1519s1c1
Sequence:CCGGGCTGGATGCAACTTGTGATTTCTCGAGAAATCACAAGTTGCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022900.3-2287s1c1
Sequence:CCGGCCCGTTCAGTTTACAGTTCATCTCGAGATGAACTGTAAACTGAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145398
VALIDATED
CASD1 MISSION shRNA Bacterial Glycerol Stock
CAS1 domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-379s21c1
Sequence:CCGGAGATTCCAGGATCCGTCAATTCTCGAGAATTGACGGATCCTGGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-1567s21c1
Sequence:CCGGTAGAGTGTGTCAGGTCTTATTCTCGAGAATAAGACCTGACACACTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-1067s21c1
Sequence:CCGGTTATCCATTATTGGGTATTTCCTCGAGGAAATACCCAATAATGGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-3078s1c1
Sequence:CCGGGCCTAAATCTTTGGACACTTTCTCGAGAAAGTGTCCAAAGATTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145398.2-734s1c1
Sequence:CCGGCCAGTTTATGAGGATCTCTTACTCGAGTAAGAGATCCTCATAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-1669s1c1
Sequence:CCGGCGTGTGGTTCATGGTCATATACTCGAGTATATGACCATGAACCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-483s1c1
Sequence:CCGGCTGCATCAGTTAAAGTGGATTCTCGAGAATCCACTTTAACTGATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-2381s1c1
Sequence:CCGGGCGCAGGTCGTTATTCCTAAACTCGAGTTTAGGAATAACGACCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145398
VALIDATED
CASD1 MISSION shRNA shRNA Plasmid DNA
CAS1 domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-379s21c1
Sequence:CCGGAGATTCCAGGATCCGTCAATTCTCGAGAATTGACGGATCCTGGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-1567s21c1
Sequence:CCGGTAGAGTGTGTCAGGTCTTATTCTCGAGAATAAGACCTGACACACTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-1067s21c1
Sequence:CCGGTTATCCATTATTGGGTATTTCCTCGAGGAAATACCCAATAATGGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-3078s1c1
Sequence:CCGGGCCTAAATCTTTGGACACTTTCTCGAGAAAGTGTCCAAAGATTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145398.2-734s1c1
Sequence:CCGGCCAGTTTATGAGGATCTCTTACTCGAGTAAGAGATCCTCATAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-1669s1c1
Sequence:CCGGCGTGTGGTTCATGGTCATATACTCGAGTATATGACCATGAACCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-483s1c1
Sequence:CCGGCTGCATCAGTTAAAGTGGATTCTCGAGAATCCACTTTAACTGATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-2381s1c1
Sequence:CCGGGCGCAGGTCGTTATTCCTAAACTCGAGTTTAGGAATAACGACCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145398
VALIDATED
CASD1 MISSION shRNA Lentiviral Transduction Particles
CAS1 domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-379s21c1
Sequence:CCGGAGATTCCAGGATCCGTCAATTCTCGAGAATTGACGGATCCTGGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-1567s21c1
Sequence:CCGGTAGAGTGTGTCAGGTCTTATTCTCGAGAATAAGACCTGACACACTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145398.2-1067s21c1
Sequence:CCGGTTATCCATTATTGGGTATTTCCTCGAGGAAATACCCAATAATGGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-3078s1c1
Sequence:CCGGGCCTAAATCTTTGGACACTTTCTCGAGAAAGTGTCCAAAGATTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145398.2-734s1c1
Sequence:CCGGCCAGTTTATGAGGATCTCTTACTCGAGTAAGAGATCCTCATAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-1669s1c1
Sequence:CCGGCGTGTGGTTCATGGTCATATACTCGAGTATATGACCATGAACCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-483s1c1
Sequence:CCGGCTGCATCAGTTAAAGTGGATTCTCGAGAATCCACTTTAACTGATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145398.2-2381s1c1
Sequence:CCGGGCGCAGGTCGTTATTCCTAAACTCGAGTTTAGGAATAACGACCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)