EMAIL THIS PAGE TO A FRIEND

CASK

calcium/calmodulin-dependent serine protein kinase (MAGUK family)

115 Gene Product Result for
Synonyms: CAGH39 CAMGUK CMG FGS4 LIN2 MICPCH MRXSNA TNRC8
Gene ID:
Human(8573) Summary: This gene encodes a calcium/calmodulin-dependent serine protein kinase. The encoded protein is a MAGUK (membrane-associated guanylate kinase) protein family member. These proteins are scaffold proteins and the encoded protein is located at synapses in the brain. Mutations in this gene are associated with FG syndrome 4, mental retardation and microcephaly with pontine and cerebellar hypoplasia, and a form of X-linked mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
Mouse(12361) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Rat(29647) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Zebrafish(259195) calcium/calmodulin-dependent serine protein kinase
fruit fly(42567) CASK ortholog
dog(480887) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Horse(100050565) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
cow(404149) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
domestic cat(101090997) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
chicken(418565) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
naked mole-rat(101697482) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
domestic guinea pig(100716257) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
sheep(101102544) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Domestic Rabbit(100350108) calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003688 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074951 MISSION® esiRNA esiRNA human CASK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126054 Rosetta Predictions human pricing
NM_001126055 Rosetta Predictions human pricing
NM_003688 siRNAs that have been validated in the lab human pricing
NM_022184 Rosetta Predictions rat pricing
NM_009806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328027 predicted 2540
2 SASI_Hs02_00328028 predicted 825
3 SASI_Hs02_00328029 predicted 2355
4 SASI_Hs02_00328030 predicted 1400
5 SASI_Hs02_00328031 predicted 1286
6 SASI_Hs02_00328032 predicted 1465
7 SASI_Hs02_00328033 predicted 277
8 SASI_Hs02_00328034 predicted 311
9 SASI_Hs02_00328035 predicted 1319
10 SASI_Hs02_00328036 predicted 2339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328037 predicted 2536
2 SASI_Hs02_00328038 predicted 820
3 SASI_Hs02_00328039 predicted 2354
4 SASI_Hs02_00328040 predicted 1384
5 SASI_Hs02_00328041 predicted 1269
6 SASI_Hs02_00328042 predicted 1443
7 SASI_Hs02_00328043 predicted 276
8 SASI_Hs02_00328044 predicted 310
9 SASI_Hs02_00328045 predicted 1300
10 SASI_Hs02_00328046 predicted 2341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003688 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212631 validated 834
1 SASI_Hs01_00212632 validated 2604
1 SASI_Hs01_00212633 validated 240
2 SASI_Hs01_00212634 predicted 828
3 SASI_Hs02_00336100 predicted 2425
4 SASI_Hs01_00212636 predicted 1403
5 SASI_Hs02_00336101 predicted 1295
6 SASI_Hs02_00336102 predicted 1465
7 SASI_Hs02_00336103 predicted 277
8 SASI_Hs02_00336104 predicted 317
9 SASI_Hs01_00212640 predicted 1318
10 SASI_Hs02_00336105 predicted 2410
11 SASI_Hs01_00212635 predicted 1004
12 SASI_Hs01_00212637 predicted 2337
13 SASI_Hs01_00212638 predicted 2239
14 SASI_Hs01_00212639 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078880 predicted 2528
2 SASI_Rn01_00078881 predicted 497
3 SASI_Rn01_00078882 predicted 1609
4 SASI_Rn01_00078883 predicted 2144
5 SASI_Rn02_00262932 predicted 2691
6 SASI_Rn01_00078884 predicted 2874
7 SASI_Rn01_00078885 predicted 2023
8 SASI_Rn01_00078886 predicted 1881
9 SASI_Rn01_00078887 predicted 2252
10 SASI_Rn01_00078888 predicted 429
11 SASI_Rn01_00078879 predicted 2249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042105 predicted 1394
2 SASI_Mm01_00042106 predicted 2611
3 SASI_Mm01_00042108 predicted 2961
4 SASI_Mm01_00042109 predicted 1812
5 SASI_Mm01_00042110 predicted 538
6 SASI_Mm02_00317086 predicted 3089
7 SASI_Mm01_00042111 predicted 2121
8 SASI_Mm01_00042113 predicted 2318
9 SASI_Mm02_00317087 predicted 1687
10 SASI_Mm02_00317088 predicted 2534
11 SASI_Mm01_00042107 predicted 2272
12 SASI_Mm01_00042112 predicted 886
13 SASI_Mm01_00042114 predicted 2649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009806
VALIDATED
CASK MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009806.1-3063s1c1
Sequence:CCGGGCCAACTATCACTCCAGGTTTCTCGAGAAACCTGGAGTGATAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-571s1c1
Sequence:CCGGCGGCGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-1765s1c1
Sequence:CCGGGCGAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-2169s1c1
Sequence:CCGGGCGAGGGAGTATTACCTTCAACTCGAGTTGAAGGTAATACTCCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-860s21c1
Sequence:CCGGCTGCGCTACTGTCATGATAATCTCGAGATTATCATGACAGTAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009806.2-3176s21c1
Sequence:CCGGCCTTGGCTATCTGAGTATAAACTCGAGTTTATACTCAGATAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-2134s21c1
Sequence:CCGGGCGAGGGAGTATTACCTTCAACTCGAGTTGAAGGTAATACTCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-1730s21c1
Sequence:CCGGGCGAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-554s21c1
Sequence:CCGGCGGCGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009806
VALIDATED
CASK MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009806.1-3063s1c1
Sequence:CCGGGCCAACTATCACTCCAGGTTTCTCGAGAAACCTGGAGTGATAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-571s1c1
Sequence:CCGGCGGCGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-1765s1c1
Sequence:CCGGGCGAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-2169s1c1
Sequence:CCGGGCGAGGGAGTATTACCTTCAACTCGAGTTGAAGGTAATACTCCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-860s21c1
Sequence:CCGGCTGCGCTACTGTCATGATAATCTCGAGATTATCATGACAGTAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009806.2-3176s21c1
Sequence:CCGGCCTTGGCTATCTGAGTATAAACTCGAGTTTATACTCAGATAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-2134s21c1
Sequence:CCGGGCGAGGGAGTATTACCTTCAACTCGAGTTGAAGGTAATACTCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-1730s21c1
Sequence:CCGGGCGAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-554s21c1
Sequence:CCGGCGGCGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009806
VALIDATED
CASK MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009806.1-3063s1c1
Sequence:CCGGGCCAACTATCACTCCAGGTTTCTCGAGAAACCTGGAGTGATAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-571s1c1
Sequence:CCGGCGGCGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-1765s1c1
Sequence:CCGGGCGAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009806.1-2169s1c1
Sequence:CCGGGCGAGGGAGTATTACCTTCAACTCGAGTTGAAGGTAATACTCCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-860s21c1
Sequence:CCGGCTGCGCTACTGTCATGATAATCTCGAGATTATCATGACAGTAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009806.2-3176s21c1
Sequence:CCGGCCTTGGCTATCTGAGTATAAACTCGAGTTTATACTCAGATAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-2134s21c1
Sequence:CCGGGCGAGGGAGTATTACCTTCAACTCGAGTTGAAGGTAATACTCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-1730s21c1
Sequence:CCGGGCGAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009806.2-554s21c1
Sequence:CCGGCGGCGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003688
VALIDATED
CASK MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003688.x-2808s1c1
Sequence:CCGGATCTGAGCATAACTGGGAGCACTCGAGTGCTCCCAGTTATGCTCAGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003688.x-1921s1c1
Sequence:CCGGCCCTGTAAAGAAGCTGGCATTCTCGAGAATGCCAGCTTCTTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.x-1300s1c1
Sequence:CCGGGCAAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003688.x-1839s1c1
Sequence:CCGGGCCATCAACTACCCAACCAAACTCGAGTTTGGTTGGGTAGTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.x-1284s1c1
Sequence:CCGGCCCTGAGAATAACGACGCAAACTCGAGTTTGCGTCGTTATTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-2441s1c1
Sequence:CCGGGCCACGAGGATGCGATGTATGCTCGAGCATACATCGCATCCTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-2314s1c1
Sequence:CCGGGCGTACCCTATTCCACATACACTCGAGTGTATGTGGAATAGGGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-811s1c1
Sequence:CCGGGCTGAAAGGATCACTGTTTATCTCGAGATAAACAGTGATCCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-999s1c1
Sequence:CCGGCCCTGAAGAGTTACCAGATTTCTCGAGAAATCTGGTAACTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-106s1c1
Sequence:CCGGCGACGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-2936s1c1
Sequence:CCGGCCGAATAGATAGGAGGAGAAACTCGAGTTTCTCCTCCTATCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-241s1c1
Sequence:CCGGCCACACATTGTAGAGTTATTGCTCGAGCAATAACTCTACAATGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-250s1c1
Sequence:CCGGGTAGAGTTATTGGAGACATATCTCGAGATATGTCTCCAATAACTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-260s21c1
Sequence:CCGGCCACACATTGTAGAGTTATTGCTCGAGCAATAACTCTACAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-125s21c1
Sequence:CCGGCGACGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-1303s21c1
Sequence:CCGGCCCTGAGAATAACGACGCAAACTCGAGTTTGCGTCGTTATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003688.3-2955s21c1
Sequence:CCGGCCGAATAGATAGGAGGAGAAACTCGAGTTTCTCCTCCTATCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003688
VALIDATED
CASK MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003688.x-2808s1c1
Sequence:CCGGATCTGAGCATAACTGGGAGCACTCGAGTGCTCCCAGTTATGCTCAGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003688.x-1921s1c1
Sequence:CCGGCCCTGTAAAGAAGCTGGCATTCTCGAGAATGCCAGCTTCTTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.x-1300s1c1
Sequence:CCGGGCAAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003688.x-1839s1c1
Sequence:CCGGGCCATCAACTACCCAACCAAACTCGAGTTTGGTTGGGTAGTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.x-1284s1c1
Sequence:CCGGCCCTGAGAATAACGACGCAAACTCGAGTTTGCGTCGTTATTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-2441s1c1
Sequence:CCGGGCCACGAGGATGCGATGTATGCTCGAGCATACATCGCATCCTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-2314s1c1
Sequence:CCGGGCGTACCCTATTCCACATACACTCGAGTGTATGTGGAATAGGGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-811s1c1
Sequence:CCGGGCTGAAAGGATCACTGTTTATCTCGAGATAAACAGTGATCCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-999s1c1
Sequence:CCGGCCCTGAAGAGTTACCAGATTTCTCGAGAAATCTGGTAACTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-106s1c1
Sequence:CCGGCGACGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-2936s1c1
Sequence:CCGGCCGAATAGATAGGAGGAGAAACTCGAGTTTCTCCTCCTATCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-241s1c1
Sequence:CCGGCCACACATTGTAGAGTTATTGCTCGAGCAATAACTCTACAATGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-250s1c1
Sequence:CCGGGTAGAGTTATTGGAGACATATCTCGAGATATGTCTCCAATAACTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-260s21c1
Sequence:CCGGCCACACATTGTAGAGTTATTGCTCGAGCAATAACTCTACAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-125s21c1
Sequence:CCGGCGACGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-1303s21c1
Sequence:CCGGCCCTGAGAATAACGACGCAAACTCGAGTTTGCGTCGTTATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003688.3-2955s21c1
Sequence:CCGGCCGAATAGATAGGAGGAGAAACTCGAGTTTCTCCTCCTATCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003688
VALIDATED
CASK MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003688.x-2808s1c1
Sequence:CCGGATCTGAGCATAACTGGGAGCACTCGAGTGCTCCCAGTTATGCTCAGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003688.x-1921s1c1
Sequence:CCGGCCCTGTAAAGAAGCTGGCATTCTCGAGAATGCCAGCTTCTTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.x-1300s1c1
Sequence:CCGGGCAAAGGAACTAAAGCGTATTCTCGAGAATACGCTTTAGTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003688.x-1839s1c1
Sequence:CCGGGCCATCAACTACCCAACCAAACTCGAGTTTGGTTGGGTAGTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.x-1284s1c1
Sequence:CCGGCCCTGAGAATAACGACGCAAACTCGAGTTTGCGTCGTTATTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-2441s1c1
Sequence:CCGGGCCACGAGGATGCGATGTATGCTCGAGCATACATCGCATCCTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-2314s1c1
Sequence:CCGGGCGTACCCTATTCCACATACACTCGAGTGTATGTGGAATAGGGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-811s1c1
Sequence:CCGGGCTGAAAGGATCACTGTTTATCTCGAGATAAACAGTGATCCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-999s1c1
Sequence:CCGGCCCTGAAGAGTTACCAGATTTCTCGAGAAATCTGGTAACTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-106s1c1
Sequence:CCGGCGACGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-2936s1c1
Sequence:CCGGCCGAATAGATAGGAGGAGAAACTCGAGTTTCTCCTCCTATCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003688.1-241s1c1
Sequence:CCGGCCACACATTGTAGAGTTATTGCTCGAGCAATAACTCTACAATGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003688.1-250s1c1
Sequence:CCGGGTAGAGTTATTGGAGACATATCTCGAGATATGTCTCCAATAACTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-260s21c1
Sequence:CCGGCCACACATTGTAGAGTTATTGCTCGAGCAATAACTCTACAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-125s21c1
Sequence:CCGGCGACGATGTATCAACAGAGAACTCGAGTTCTCTGTTGATACATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003688.3-1303s21c1
Sequence:CCGGCCCTGAGAATAACGACGCAAACTCGAGTTTGCGTCGTTATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003688.3-2955s21c1
Sequence:CCGGCCGAATAGATAGGAGGAGAAACTCGAGTTTCTCCTCCTATCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks