EMAIL THIS PAGE TO A FRIEND

CASKIN1

CASK interacting protein 1

64 Gene Product Result for
Synonyms: ANKS5A
UniProtKB ID: Q8WXD9, Q9P2P0
Gene ID:
Mouse(268932) CASK interacting protein 1
Rat(140722) CASK interacting protein 1
Zebrafish(563678) CASK interacting protein 1
cow(614560) CASK interacting protein 1
Horse(100068183) CASK interacting protein 1
domestic cat(101082456) CASK interacting protein 1
chicken(416556) CASK interacting protein 1
dog(610943) CASK interacting protein 1
sheep(101114411) CASK interacting protein 1
domestic guinea pig(100732339) CASK interacting protein 1
naked mole-rat(101712285) CASK interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020764 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_196170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_196170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_196170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020764 Rosetta Predictions human pricing
NM_080690 Rosetta Predictions rat pricing
NM_027937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178257 predicted 1595
2 SASI_Hs01_00178258 predicted 1186
3 SASI_Hs01_00178259 predicted 343
4 SASI_Hs02_00353886 predicted 2919
5 SASI_Hs01_00178260 predicted 4768
6 SASI_Hs01_00178262 predicted 602
7 SASI_Hs01_00178263 predicted 1725
8 SASI_Hs01_00178264 predicted 894
9 SASI_Hs01_00178265 predicted 1712
10 SASI_Hs02_00353887 predicted 1694
11 SASI_Hs01_00178261 predicted 3013
12 SASI_Hs01_00178266 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063053 predicted 1149
2 SASI_Rn01_00063054 predicted 1737
3 SASI_Rn01_00063055 predicted 2107
4 SASI_Rn01_00063056 predicted 480
5 SASI_Rn01_00063057 predicted 1026
6 SASI_Rn01_00063058 predicted 277
7 SASI_Rn01_00063059 predicted 1867
8 SASI_Rn01_00063060 predicted 1037
9 SASI_Rn02_00267275 predicted 1996
10 SASI_Rn01_00063061 predicted 2974
11 SASI_Rn01_00063062 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092496 predicted 497
2 SASI_Mm01_00092497 predicted 959
3 SASI_Mm01_00092499 predicted 537
4 SASI_Mm01_00092500 predicted 1111
5 SASI_Mm01_00092501 predicted 558
6 SASI_Mm01_00092504 predicted 3630
7 SASI_Mm01_00092505 predicted 2015
8 SASI_Mm02_00332930 predicted 1684
9 SASI_Mm02_00332931 predicted 819
10 SASI_Mm02_00332932 predicted 1040
11 SASI_Mm01_00092498 predicted 2001
12 SASI_Mm01_00092502 predicted 1056
13 SASI_Mm01_00092503 predicted 2697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020764
VALIDATED
CASKIN1 MISSION shRNA Bacterial Glycerol Stock
CASK interacting protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-2804s21c1
Sequence:CCGGAGGTGCCGACAAGAACGTCAACTCGAGTTGACGTTCTTGTCGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-606s21c1
Sequence:CCGGCCTTTGCACCTCGCAGCTAAACTCGAGTTTAGCTGCGAGGTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020764.3-4777s21c1
Sequence:CCGGGAATGAGCTGAGGCGGATTTCCTCGAGGAAATCCGCCTCAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-1288s21c1
Sequence:CCGGTTTCCCAGAAGTCCGTCTCTGCTCGAGCAGAGACGGACTTCTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-1772s1c1
Sequence:CCGGCTACAAGGTGTTGGTGGACAACTCGAGTTGTCCACCAACACCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020764.1-1766s1c1
Sequence:CCGGCCAGTACTACAAGGTGTTGGTCTCGAGACCAACACCTTGTAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-272s1c1
Sequence:CCGGGAACGGCAACACGGAATTGATCTCGAGATCAATTCCGTGTTGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-1916s1c1
Sequence:CCGGGAAGGCTGAATACGCCAAGTACTCGAGTACTTGGCGTATTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-3235s1c1
Sequence:CCGGCAGTGAAACACAAAGAGGCCACTCGAGTGGCCTCTTTGTGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-3500s1c1
Sequence:CCGGGCAGGAGAACGTCAAGTTCATCTCGAGATGAACTTGACGTTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-471s1c1
Sequence:CCGGCATGGTCACTATGATGTGTCTCTCGAGAGACACATCATAGTGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-1788s1c1
Sequence:CCGGGACAATGGCTACGAGAACATTCTCGAGAATGTTCTCGTAGCCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-962s1c1
Sequence:CCGGGACCAAGGATTATTGCAACAACTCGAGTTGTTGCAATAATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020764.2-5425s1c1
Sequence:CCGGGCACAACTTTGACGTTTCTTACTCGAGTAAGAAACGTCAAAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020764
VALIDATED
CASKIN1 MISSION shRNA shRNA Plasmid DNA
CASK interacting protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-2804s21c1
Sequence:CCGGAGGTGCCGACAAGAACGTCAACTCGAGTTGACGTTCTTGTCGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-606s21c1
Sequence:CCGGCCTTTGCACCTCGCAGCTAAACTCGAGTTTAGCTGCGAGGTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020764.3-4777s21c1
Sequence:CCGGGAATGAGCTGAGGCGGATTTCCTCGAGGAAATCCGCCTCAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-1288s21c1
Sequence:CCGGTTTCCCAGAAGTCCGTCTCTGCTCGAGCAGAGACGGACTTCTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-1772s1c1
Sequence:CCGGCTACAAGGTGTTGGTGGACAACTCGAGTTGTCCACCAACACCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020764.1-1766s1c1
Sequence:CCGGCCAGTACTACAAGGTGTTGGTCTCGAGACCAACACCTTGTAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-272s1c1
Sequence:CCGGGAACGGCAACACGGAATTGATCTCGAGATCAATTCCGTGTTGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-1916s1c1
Sequence:CCGGGAAGGCTGAATACGCCAAGTACTCGAGTACTTGGCGTATTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-3235s1c1
Sequence:CCGGCAGTGAAACACAAAGAGGCCACTCGAGTGGCCTCTTTGTGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-3500s1c1
Sequence:CCGGGCAGGAGAACGTCAAGTTCATCTCGAGATGAACTTGACGTTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-471s1c1
Sequence:CCGGCATGGTCACTATGATGTGTCTCTCGAGAGACACATCATAGTGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-1788s1c1
Sequence:CCGGGACAATGGCTACGAGAACATTCTCGAGAATGTTCTCGTAGCCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-962s1c1
Sequence:CCGGGACCAAGGATTATTGCAACAACTCGAGTTGTTGCAATAATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020764.2-5425s1c1
Sequence:CCGGGCACAACTTTGACGTTTCTTACTCGAGTAAGAAACGTCAAAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020764
VALIDATED
CASKIN1 MISSION shRNA Lentiviral Transduction Particles
CASK interacting protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-2804s21c1
Sequence:CCGGAGGTGCCGACAAGAACGTCAACTCGAGTTGACGTTCTTGTCGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-606s21c1
Sequence:CCGGCCTTTGCACCTCGCAGCTAAACTCGAGTTTAGCTGCGAGGTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020764.3-4777s21c1
Sequence:CCGGGAATGAGCTGAGGCGGATTTCCTCGAGGAAATCCGCCTCAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020764.3-1288s21c1
Sequence:CCGGTTTCCCAGAAGTCCGTCTCTGCTCGAGCAGAGACGGACTTCTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-1772s1c1
Sequence:CCGGCTACAAGGTGTTGGTGGACAACTCGAGTTGTCCACCAACACCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020764.1-1766s1c1
Sequence:CCGGCCAGTACTACAAGGTGTTGGTCTCGAGACCAACACCTTGTAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-272s1c1
Sequence:CCGGGAACGGCAACACGGAATTGATCTCGAGATCAATTCCGTGTTGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-1916s1c1
Sequence:CCGGGAAGGCTGAATACGCCAAGTACTCGAGTACTTGGCGTATTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-3235s1c1
Sequence:CCGGCAGTGAAACACAAAGAGGCCACTCGAGTGGCCTCTTTGTGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-3500s1c1
Sequence:CCGGGCAGGAGAACGTCAAGTTCATCTCGAGATGAACTTGACGTTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-471s1c1
Sequence:CCGGCATGGTCACTATGATGTGTCTCTCGAGAGACACATCATAGTGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020764.1-1788s1c1
Sequence:CCGGGACAATGGCTACGAGAACATTCTCGAGAATGTTCTCGTAGCCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020764.1-962s1c1
Sequence:CCGGGACCAAGGATTATTGCAACAACTCGAGTTGTTGCAATAATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020764.2-5425s1c1
Sequence:CCGGGCACAACTTTGACGTTTCTTACTCGAGTAAGAAACGTCAAAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_196170
CASKIN1 MISSION shRNA Bacterial Glycerol Stock
CASK interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_196170.3-5730s1c1
Sequence:CCGGCCGCCCATCTTTAATTCCCATCTCGAGATGGGAATTAAAGATGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-2076s1c1
Sequence:CCGGCGGCTATGAGAACATTGATTTCTCGAGAAATCAATGTTCTCATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-538s1c1
Sequence:CCGGGCCCTGAATGGCAACACAGAACTCGAGTTCTGTGTTGCCATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-864s1c1
Sequence:CCGGGCTGCTGCTAAGTAGCAACATCTCGAGATGTTGCTACTTAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-1141s1c1
Sequence:CCGGCTGGACATTGTACACCAATTTCTCGAGAAATTGGTGTACAATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_196170
CASKIN1 MISSION shRNA shRNA Plasmid DNA
CASK interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_196170.3-5730s1c1
Sequence:CCGGCCGCCCATCTTTAATTCCCATCTCGAGATGGGAATTAAAGATGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-2076s1c1
Sequence:CCGGCGGCTATGAGAACATTGATTTCTCGAGAAATCAATGTTCTCATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-538s1c1
Sequence:CCGGGCCCTGAATGGCAACACAGAACTCGAGTTCTGTGTTGCCATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-864s1c1
Sequence:CCGGGCTGCTGCTAAGTAGCAACATCTCGAGATGTTGCTACTTAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-1141s1c1
Sequence:CCGGCTGGACATTGTACACCAATTTCTCGAGAAATTGGTGTACAATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_196170
CASKIN1 MISSION shRNA Lentiviral Transduction Particles
CASK interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_196170.3-5730s1c1
Sequence:CCGGCCGCCCATCTTTAATTCCCATCTCGAGATGGGAATTAAAGATGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-2076s1c1
Sequence:CCGGCGGCTATGAGAACATTGATTTCTCGAGAAATCAATGTTCTCATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-538s1c1
Sequence:CCGGGCCCTGAATGGCAACACAGAACTCGAGTTCTGTGTTGCCATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-864s1c1
Sequence:CCGGGCTGCTGCTAAGTAGCAACATCTCGAGATGTTGCTACTTAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196170.3-1141s1c1
Sequence:CCGGCTGGACATTGTACACCAATTTCTCGAGAAATTGGTGTACAATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks