EMAIL THIS PAGE TO A FRIEND

CASKIN2

CASK interacting protein 2

66 Gene Product Result for
Synonyms: ANKS5B
UniProtKB ID: Q8WXE0, B4DTT3, B7Z9H1, Q7LG69, Q9ULT1
Gene ID:
Human(57513) Summary: This gene encodes a large protein that contains six ankyrin repeats, as well as a Src homology 3 (SH3) domain and two sterile alpha motif (SAM) domains, which may be involved in protein-protein interactions. The C-terminal portion of this protein is proline-rich and contains a conserved region. A related protein interacts with calcium/calmodulin-dependent serine protein kinase (CASK). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Mouse(140721) CASK-interacting protein 2
Rat(303678) cask-interacting protein 2
naked mole-rat(101719090) CASK interacting protein 2
domestic guinea pig(100716205) CASK interacting protein 2
sheep(101120933) CASK interacting protein 2
chicken(422125) CASK interacting protein 2
dog(483314) CASK interacting protein 2
Horse(100051742) CASK interacting protein 2
cow(789036) CASK interacting protein 2
domestic cat(101100349) CASK interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020753 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029821 MISSION® esiRNA esiRNA human CASKIN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020753 Rosetta Predictions human pricing
NM_001107065 Rosetta Predictions rat pricing
NM_080643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175456 predicted 1227
2 SASI_Hs01_00175457 predicted 2082
3 SASI_Hs02_00353875 predicted 592
4 SASI_Hs01_00175458 predicted 2069
5 SASI_Hs02_00353876 predicted 732
6 SASI_Hs01_00175460 predicted 653
7 SASI_Hs01_00175461 predicted 927
8 SASI_Hs01_00175463 predicted 3757
9 SASI_Hs01_00175464 predicted 1287
10 SASI_Hs01_00175465 predicted 576
11 SASI_Hs01_00175459 predicted 1286
12 SASI_Hs01_00175462 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225146 predicted 2141
2 SASI_Rn02_00225147 predicted 1394
3 SASI_Rn02_00225148 predicted 1164
4 SASI_Rn02_00225149 predicted 3751
5 SASI_Rn02_00225150 predicted 1121
6 SASI_Rn02_00225151 predicted 594
7 SASI_Rn02_00225152 predicted 892
8 SASI_Rn02_00225153 predicted 648
9 SASI_Rn02_00225154 predicted 2184
10 SASI_Rn02_00225155 predicted 2715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129208 predicted 2737
2 SASI_Mm01_00129209 predicted 985
3 SASI_Mm01_00129210 predicted 853
4 SASI_Mm01_00129211 predicted 2143
5 SASI_Mm01_00129212 predicted 1070
6 SASI_Mm01_00129213 predicted 4137
7 SASI_Mm01_00129214 predicted 546
8 SASI_Mm01_00129215 predicted 1338
9 SASI_Mm01_00129216 predicted 1081
10 SASI_Mm01_00129217 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020753
VALIDATED
CASKIN2 MISSION shRNA Bacterial Glycerol Stock
CASK interacting protein 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-3500s1c1
Sequence:CCGGCTCACGGAATCAGACACTGTTCTCGAGAACAGTGTCTGATTCCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-668s1c1
Sequence:CCGGCTCAACGTGAACTACCAGGATCTCGAGATCCTGGTAGTTCACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-4086s1c1
Sequence:CCGGCCAAGCACATTCTGGATGACACTCGAGTGTCATCCAGAATGTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-1469s1c1
Sequence:CCGGGATGTCATCACGGTGCTAGAACTCGAGTTCTAGCACCGTGATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-2024s1c1
Sequence:CCGGCAGGCCATTCATAACTGGCTACTCGAGTAGCCAGTTATGAATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020753.2-3502s1c1
Sequence:CCGGCACGGAATCAGACACTGTTAACTCGAGTTAACAGTGTCTGATTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020753.2-1320s1c1
Sequence:CCGGCGCTGGACATAGTGAATCAGTCTCGAGACTGATTCACTATGTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1540s21c1
Sequence:CCGGCACAGACCGCATAGGCTACTTCTCGAGAAGTAGCCTATGCGGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-3770s21c1
Sequence:CCGGTCAGCAGCTAGTCGGTGGAATCTCGAGATTCCACCGACTAGCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-967s21c1
Sequence:CCGGCAACCCATGCCTGGTCAACAACTCGAGTTGTTGACCAGGCATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020753.3-4389s21c1
Sequence:CCGGCTCCCAGGGTTTGATCGATTGCTCGAGCAATCGATCAAACCCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020753.3-4615s21c1
Sequence:CCGGGTAGGTGTACAGAGGACATGTCTCGAGACATGTCCTCTGTACACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1047s21c1
Sequence:CCGGTGCTTCTGAACAGCCACTTATCTCGAGATAAGTGGCTGTTCAGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1285s21c1
Sequence:CCGGGGACGTGAACATCCGGAATACCTCGAGGTATTCCGGATGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1176s21c1
Sequence:CCGGTGAGAGCTGGGATCGAGATCACTCGAGTGATCTCGATCCCAGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020753
VALIDATED
CASKIN2 MISSION shRNA shRNA Plasmid DNA
CASK interacting protein 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-3500s1c1
Sequence:CCGGCTCACGGAATCAGACACTGTTCTCGAGAACAGTGTCTGATTCCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-668s1c1
Sequence:CCGGCTCAACGTGAACTACCAGGATCTCGAGATCCTGGTAGTTCACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-4086s1c1
Sequence:CCGGCCAAGCACATTCTGGATGACACTCGAGTGTCATCCAGAATGTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-1469s1c1
Sequence:CCGGGATGTCATCACGGTGCTAGAACTCGAGTTCTAGCACCGTGATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-2024s1c1
Sequence:CCGGCAGGCCATTCATAACTGGCTACTCGAGTAGCCAGTTATGAATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020753.2-3502s1c1
Sequence:CCGGCACGGAATCAGACACTGTTAACTCGAGTTAACAGTGTCTGATTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020753.2-1320s1c1
Sequence:CCGGCGCTGGACATAGTGAATCAGTCTCGAGACTGATTCACTATGTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1540s21c1
Sequence:CCGGCACAGACCGCATAGGCTACTTCTCGAGAAGTAGCCTATGCGGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-3770s21c1
Sequence:CCGGTCAGCAGCTAGTCGGTGGAATCTCGAGATTCCACCGACTAGCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-967s21c1
Sequence:CCGGCAACCCATGCCTGGTCAACAACTCGAGTTGTTGACCAGGCATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020753.3-4389s21c1
Sequence:CCGGCTCCCAGGGTTTGATCGATTGCTCGAGCAATCGATCAAACCCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020753.3-4615s21c1
Sequence:CCGGGTAGGTGTACAGAGGACATGTCTCGAGACATGTCCTCTGTACACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1047s21c1
Sequence:CCGGTGCTTCTGAACAGCCACTTATCTCGAGATAAGTGGCTGTTCAGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1285s21c1
Sequence:CCGGGGACGTGAACATCCGGAATACCTCGAGGTATTCCGGATGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1176s21c1
Sequence:CCGGTGAGAGCTGGGATCGAGATCACTCGAGTGATCTCGATCCCAGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020753
VALIDATED
CASKIN2 MISSION shRNA Lentiviral Transduction Particles
CASK interacting protein 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-3500s1c1
Sequence:CCGGCTCACGGAATCAGACACTGTTCTCGAGAACAGTGTCTGATTCCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-668s1c1
Sequence:CCGGCTCAACGTGAACTACCAGGATCTCGAGATCCTGGTAGTTCACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-4086s1c1
Sequence:CCGGCCAAGCACATTCTGGATGACACTCGAGTGTCATCCAGAATGTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-1469s1c1
Sequence:CCGGGATGTCATCACGGTGCTAGAACTCGAGTTCTAGCACCGTGATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020753.2-2024s1c1
Sequence:CCGGCAGGCCATTCATAACTGGCTACTCGAGTAGCCAGTTATGAATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020753.2-3502s1c1
Sequence:CCGGCACGGAATCAGACACTGTTAACTCGAGTTAACAGTGTCTGATTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020753.2-1320s1c1
Sequence:CCGGCGCTGGACATAGTGAATCAGTCTCGAGACTGATTCACTATGTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1540s21c1
Sequence:CCGGCACAGACCGCATAGGCTACTTCTCGAGAAGTAGCCTATGCGGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-3770s21c1
Sequence:CCGGTCAGCAGCTAGTCGGTGGAATCTCGAGATTCCACCGACTAGCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-967s21c1
Sequence:CCGGCAACCCATGCCTGGTCAACAACTCGAGTTGTTGACCAGGCATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020753.3-4389s21c1
Sequence:CCGGCTCCCAGGGTTTGATCGATTGCTCGAGCAATCGATCAAACCCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020753.3-4615s21c1
Sequence:CCGGGTAGGTGTACAGAGGACATGTCTCGAGACATGTCCTCTGTACACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1047s21c1
Sequence:CCGGTGCTTCTGAACAGCCACTTATCTCGAGATAAGTGGCTGTTCAGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1285s21c1
Sequence:CCGGGGACGTGAACATCCGGAATACCTCGAGGTATTCCGGATGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020753.3-1176s21c1
Sequence:CCGGTGAGAGCTGGGATCGAGATCACTCGAGTGATCTCGATCCCAGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080643
VALIDATED
CASKIN2 MISSION shRNA Bacterial Glycerol Stock
CASK interacting protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080643.2-4362s1c1
Sequence:CCGGCTCGTAGAACATTCTCCTCTACTCGAGTAGAGGAGAATGTTCTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1292s1c1
Sequence:CCGGCGGGAAATCAAGCAGCTACTTCTCGAGAAGTAGCTGCTTGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080643.2-907s1c1
Sequence:CCGGCCTAGTCAACAAGTTGAAGAACTCGAGTTCTTCAACTTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1099s1c1
Sequence:CCGGGCAGCTCTTGAAAGCTGGTATCTCGAGATACCAGCTTTCAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1100s1c1
Sequence:CCGGCAGCTCTTGAAAGCTGGTATTCTCGAGAATACCAGCTTTCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080643.2-4413s21c1
Sequence:CCGGCACCTCCTTGCCTTGTCTAAACTCGAGTTTAGACAAGGCAAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-1330s21c1
Sequence:CCGGCTTGAAGGTTCGAGCGCTTAACTCGAGTTAAGCGCTCGAACCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-2133s21c1
Sequence:CCGGCTGAGTGGCTGCCCAATTATACTCGAGTATAATTGGGCAGCCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-4017s21c1
Sequence:CCGGAGCACATTCTGGATGACATTACTCGAGTAATGTCATCCAGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-907s21c1
Sequence:CCGGCCTAGTCAACAAGTTGAAGAACTCGAGTTCTTCAACTTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080643
VALIDATED
CASKIN2 MISSION shRNA shRNA Plasmid DNA
CASK interacting protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080643.2-4362s1c1
Sequence:CCGGCTCGTAGAACATTCTCCTCTACTCGAGTAGAGGAGAATGTTCTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1292s1c1
Sequence:CCGGCGGGAAATCAAGCAGCTACTTCTCGAGAAGTAGCTGCTTGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080643.2-907s1c1
Sequence:CCGGCCTAGTCAACAAGTTGAAGAACTCGAGTTCTTCAACTTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1099s1c1
Sequence:CCGGGCAGCTCTTGAAAGCTGGTATCTCGAGATACCAGCTTTCAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1100s1c1
Sequence:CCGGCAGCTCTTGAAAGCTGGTATTCTCGAGAATACCAGCTTTCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080643.2-4413s21c1
Sequence:CCGGCACCTCCTTGCCTTGTCTAAACTCGAGTTTAGACAAGGCAAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-1330s21c1
Sequence:CCGGCTTGAAGGTTCGAGCGCTTAACTCGAGTTAAGCGCTCGAACCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-2133s21c1
Sequence:CCGGCTGAGTGGCTGCCCAATTATACTCGAGTATAATTGGGCAGCCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-4017s21c1
Sequence:CCGGAGCACATTCTGGATGACATTACTCGAGTAATGTCATCCAGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-907s21c1
Sequence:CCGGCCTAGTCAACAAGTTGAAGAACTCGAGTTCTTCAACTTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080643
VALIDATED
CASKIN2 MISSION shRNA Lentiviral Transduction Particles
CASK interacting protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080643.2-4362s1c1
Sequence:CCGGCTCGTAGAACATTCTCCTCTACTCGAGTAGAGGAGAATGTTCTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1292s1c1
Sequence:CCGGCGGGAAATCAAGCAGCTACTTCTCGAGAAGTAGCTGCTTGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080643.2-907s1c1
Sequence:CCGGCCTAGTCAACAAGTTGAAGAACTCGAGTTCTTCAACTTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1099s1c1
Sequence:CCGGGCAGCTCTTGAAAGCTGGTATCTCGAGATACCAGCTTTCAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080643.2-1100s1c1
Sequence:CCGGCAGCTCTTGAAAGCTGGTATTCTCGAGAATACCAGCTTTCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080643.2-4413s21c1
Sequence:CCGGCACCTCCTTGCCTTGTCTAAACTCGAGTTTAGACAAGGCAAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-1330s21c1
Sequence:CCGGCTTGAAGGTTCGAGCGCTTAACTCGAGTTAAGCGCTCGAACCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-2133s21c1
Sequence:CCGGCTGAGTGGCTGCCCAATTATACTCGAGTATAATTGGGCAGCCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-4017s21c1
Sequence:CCGGAGCACATTCTGGATGACATTACTCGAGTAATGTCATCCAGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080643.2-907s21c1
Sequence:CCGGCCTAGTCAACAAGTTGAAGAACTCGAGTTCTTCAACTTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks