EMAIL THIS PAGE TO A FRIEND

CASP10

caspase 10, apoptosis-related cysteine peptidase

69 Gene Product Result for
Synonyms: ALPS2 FLICE2 MCH4
Gene ID:
Human(843) Summary: This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
naked mole-rat(101712620) caspase 10, apoptosis-related cysteine peptidase
domestic guinea pig(100717714) caspase 10, apoptosis-related cysteine peptidase
chicken(424081) caspase 10, apoptosis-related cysteine peptidase
domestic cat(101085995) caspase 10, apoptosis-related cysteine peptidase
cow(100848685) caspase 10, apoptosis-related cysteine peptidase
Horse(100068201) caspase 10, apoptosis-related cysteine peptidase
dog(488472) caspase 10, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
SCP0094 Caspase Inhibitor ≥97% (HPLC) human pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
SCP0102 Caspase Substrate ≥97% (HPLC) pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001230 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066811 MISSION® esiRNA esiRNA human CASP10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001230 Rosetta Predictions human pricing
NM_032974 Rosetta Predictions human pricing
NM_032977 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331397 predicted 486
2 SASI_Hs01_00165504 predicted 856
3 SASI_Hs01_00165505 predicted 733
4 SASI_Hs02_00331398 predicted 859
5 SASI_Hs01_00165506 predicted 426
6 SASI_Hs01_00165507 predicted 436
7 SASI_Hs02_00331399 predicted 468
8 SASI_Hs02_00331400 predicted 859
9 SASI_Hs01_00165509 predicted 826
10 SASI_Hs01_00165512 predicted 844
11 SASI_Hs01_00165508 predicted 1421
12 SASI_Hs01_00165510 predicted 578
13 SASI_Hs01_00165511 predicted 804
14 SASI_Hs01_00165513 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360603 predicted 477
2 SASI_Hs01_00067375 predicted 854
3 SASI_Hs01_00067376 predicted 738
4 SASI_Hs02_00360604 predicted 856
5 SASI_Hs01_00067377 predicted 430
6 SASI_Hs01_00067378 predicted 435
7 SASI_Hs02_00360605 predicted 466
8 SASI_Hs02_00360606 predicted 863
9 SASI_Hs01_00067380 predicted 824
10 SASI_Hs01_00067383 predicted 850
11 SASI_Hs01_00067379 predicted 1544
12 SASI_Hs01_00067381 predicted 580
13 SASI_Hs01_00067382 predicted 806
14 SASI_Hs01_00067384 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360608 predicted 483
2 SASI_Hs01_00213343 predicted 854
3 SASI_Hs01_00213344 predicted 736
4 SASI_Hs02_00360609 predicted 854
5 SASI_Hs01_00213345 predicted 422
6 SASI_Hs01_00213346 predicted 439
7 SASI_Hs02_00360610 predicted 464
8 SASI_Hs02_00360611 predicted 862
9 SASI_Hs01_00213348 predicted 822
10 SASI_Hs01_00213351 predicted 846
11 SASI_Hs01_00213347 predicted 1541
12 SASI_Hs01_00213349 predicted 580
13 SASI_Hs01_00213350 predicted 802
14 SASI_Hs01_00213352 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001230
CASP10 MISSION shRNA Bacterial Glycerol Stock
caspase 10, apoptosis-related cysteine peptidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-958s1c1
Sequence:CCGGAGGACAGACAAGGAACCCATACTCGAGTATGGGTTCCTTGTCTGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001230.x-3007s1c1
Sequence:CCGGCCCACCTTGTTACTGCTACTACTCGAGTAGTAGCAGTAACAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-638s1c1
Sequence:CCGGCTCCCTAAGTTTCCTGGCATTCTCGAGAATGCCAGGAAACTTAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-311s1c1
Sequence:CCGGCAAGTTTCTCTGCATAGGATTCTCGAGAATCCTATGCAGAGAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-1612s1c1
Sequence:CCGGCCCTGGATGCACTTTCAATATCTCGAGATATTGAAAGTGCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001230.4-793s21c1
Sequence:CCGGCATTGACTCAGAGAACTTAAACTCGAGTTTAAGTTCTCTGAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001230.4-1887s21c1
Sequence:CCGGCAAACGAATCATTGGCTATAACTCGAGTTATAGCCAATGATTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001230.4-479s21c1
Sequence:CCGGCGTGAGAAGCTTCTGATTATTCTCGAGAATAATCAGAAGCTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001230
CASP10 MISSION shRNA shRNA Plasmid DNA
caspase 10, apoptosis-related cysteine peptidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-958s1c1
Sequence:CCGGAGGACAGACAAGGAACCCATACTCGAGTATGGGTTCCTTGTCTGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001230.x-3007s1c1
Sequence:CCGGCCCACCTTGTTACTGCTACTACTCGAGTAGTAGCAGTAACAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-638s1c1
Sequence:CCGGCTCCCTAAGTTTCCTGGCATTCTCGAGAATGCCAGGAAACTTAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-311s1c1
Sequence:CCGGCAAGTTTCTCTGCATAGGATTCTCGAGAATCCTATGCAGAGAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-1612s1c1
Sequence:CCGGCCCTGGATGCACTTTCAATATCTCGAGATATTGAAAGTGCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001230.4-793s21c1
Sequence:CCGGCATTGACTCAGAGAACTTAAACTCGAGTTTAAGTTCTCTGAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001230.4-1887s21c1
Sequence:CCGGCAAACGAATCATTGGCTATAACTCGAGTTATAGCCAATGATTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001230.4-479s21c1
Sequence:CCGGCGTGAGAAGCTTCTGATTATTCTCGAGAATAATCAGAAGCTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001230
CASP10 MISSION shRNA Lentiviral Transduction Particles
caspase 10, apoptosis-related cysteine peptidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-958s1c1
Sequence:CCGGAGGACAGACAAGGAACCCATACTCGAGTATGGGTTCCTTGTCTGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001230.x-3007s1c1
Sequence:CCGGCCCACCTTGTTACTGCTACTACTCGAGTAGTAGCAGTAACAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-638s1c1
Sequence:CCGGCTCCCTAAGTTTCCTGGCATTCTCGAGAATGCCAGGAAACTTAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-311s1c1
Sequence:CCGGCAAGTTTCTCTGCATAGGATTCTCGAGAATCCTATGCAGAGAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001230.x-1612s1c1
Sequence:CCGGCCCTGGATGCACTTTCAATATCTCGAGATATTGAAAGTGCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001230.4-793s21c1
Sequence:CCGGCATTGACTCAGAGAACTTAAACTCGAGTTTAAGTTCTCTGAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001230.4-1887s21c1
Sequence:CCGGCAAACGAATCATTGGCTATAACTCGAGTTATAGCCAATGATTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001230.4-479s21c1
Sequence:CCGGCGTGAGAAGCTTCTGATTATTCTCGAGAATAATCAGAAGCTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks