EMAIL THIS PAGE TO A FRIEND

CASP12

caspase 12 (gene/pseudogene)

40 Gene Product Result for
Synonyms: CASP-12 CASP12P1
UniProtKB ID: Q6UXS9, D6RBN7
Gene ID:
Human(100506742) Summary: Caspases are cysteine proteases that cleave C-terminal aspartic acid residues on their substrate molecules. This gene is most highly related to members of the ICE subfamily of caspases that process inflammatory cytokines. In rodents, the homolog of this gene mediates apoptosis in response to endoplasmic reticulum stress. However, in humans this gene contains a polymorphism for the presence or absence of a premature stop codon. The majority of human individuals have the premature stop codon and produce a truncated non-functional protein. The read-through codon occurs primarily in individuals of African descent and carriers have endotoxin hypo-responsiveness and an increased susceptibility to severe sepsis. Several alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Feb 2011]
Mouse(12364) caspase 12
Rat(156117) caspase 12
dog(479458) caspase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900770 Anti-CASP12 / CASPASE 12 antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB2900773 Anti-CASP12 / CASPASE 12 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB2502104 Anti-CASP12 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA046232 Anti-CASP12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
PRS2325 Anti-CASPASE-12 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
PRS2327 Anti-CASPASE-12 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3195 Anti-Caspase-12 (large) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3197 Anti-Caspase-12 (small) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
C7611 Monoclonal Anti-Caspase 12 antibody produced in rat clone 14F7, purified immunoglobulin, buffered aqueous solution rat, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031621 MISSION® esiRNA esiRNA targeting mouse Casp12 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130422 Rosetta Predictions rat pricing
NM_009808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053058 predicted 830
2 SASI_Rn01_00053059 predicted 263
3 SASI_Rn01_00053060 predicted 998
4 SASI_Rn01_00053061 predicted 249
5 SASI_Rn01_00053062 predicted 245
6 SASI_Rn01_00053063 predicted 990
7 SASI_Rn02_00267422 predicted 611
8 SASI_Rn01_00053064 predicted 986
9 SASI_Rn01_00053065 predicted 400
10 SASI_Rn01_00053067 predicted 426
11 SASI_Rn01_00053066 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158449 predicted 326
2 SASI_Mm01_00158450 predicted 1021
3 SASI_Mm01_00158451 predicted 377
4 SASI_Mm01_00158452 predicted 1086
5 SASI_Mm01_00158453 predicted 459
6 SASI_Mm01_00158454 predicted 700
7 SASI_Mm01_00158455 predicted 1212
8 SASI_Mm01_00158456 predicted 721
9 SASI_Mm01_00158457 predicted 1333
10 SASI_Mm02_00317090 predicted 898
11 SASI_Mm01_00158458 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009808
VALIDATED
CASP12 MISSION shRNA Bacterial Glycerol Stock
caspase 12 (gene/pseudogene)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-1007s21c1
Sequence:CCGGGAACGTGTGTTGAGCTGTAAACTCGAGTTTACAGCTCAACACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009808.4-1723s21c1
Sequence:CCGGTACTCACAAGGAAGATCTTATCTCGAGATAAGATCTTCCTTGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-383s21c1
Sequence:CCGGGATGATGAAATGGAGGTAAATCTCGAGATTTACCTCCATTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009808.4-1687s21c1
Sequence:CCGGTGAACCACTTTCACCTATAAACTCGAGTTTATAGGTGAAAGTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-1165s21c1
Sequence:CCGGGTACTGTTGGTGTTATCATTTCTCGAGAAATGATAACACCAACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-1406s1c1
Sequence:CCGGGCTAGATAATTTCCATAGGTTCTCGAGAACCTATGGAAATTATCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-550s1c1
Sequence:CCGGGCTCTCATCATCTGCAACAAACTCGAGTTTGTTGCAGATGATGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-1220s1c1
Sequence:CCGGTGCCCACTATTGAGAGAGTATCTCGAGATACTCTCTCAATAGTGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-46s1c1
Sequence:CCGGGATCCAATCTACAAGATCAAACTCGAGTTTGATCTTGTAGATTGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009808.2-1065s1c1
Sequence:CCGGCCCACATAATATTTCTTGGAACTCGAGTTCCAAGAAATATTATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009808
VALIDATED
CASP12 MISSION shRNA shRNA Plasmid DNA
caspase 12 (gene/pseudogene)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-1007s21c1
Sequence:CCGGGAACGTGTGTTGAGCTGTAAACTCGAGTTTACAGCTCAACACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009808.4-1723s21c1
Sequence:CCGGTACTCACAAGGAAGATCTTATCTCGAGATAAGATCTTCCTTGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-383s21c1
Sequence:CCGGGATGATGAAATGGAGGTAAATCTCGAGATTTACCTCCATTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009808.4-1687s21c1
Sequence:CCGGTGAACCACTTTCACCTATAAACTCGAGTTTATAGGTGAAAGTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-1165s21c1
Sequence:CCGGGTACTGTTGGTGTTATCATTTCTCGAGAAATGATAACACCAACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-1406s1c1
Sequence:CCGGGCTAGATAATTTCCATAGGTTCTCGAGAACCTATGGAAATTATCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-550s1c1
Sequence:CCGGGCTCTCATCATCTGCAACAAACTCGAGTTTGTTGCAGATGATGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-1220s1c1
Sequence:CCGGTGCCCACTATTGAGAGAGTATCTCGAGATACTCTCTCAATAGTGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-46s1c1
Sequence:CCGGGATCCAATCTACAAGATCAAACTCGAGTTTGATCTTGTAGATTGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009808.2-1065s1c1
Sequence:CCGGCCCACATAATATTTCTTGGAACTCGAGTTCCAAGAAATATTATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009808
VALIDATED
CASP12 MISSION shRNA Lentiviral Transduction Particles
caspase 12 (gene/pseudogene)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-1007s21c1
Sequence:CCGGGAACGTGTGTTGAGCTGTAAACTCGAGTTTACAGCTCAACACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009808.4-1723s21c1
Sequence:CCGGTACTCACAAGGAAGATCTTATCTCGAGATAAGATCTTCCTTGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-383s21c1
Sequence:CCGGGATGATGAAATGGAGGTAAATCTCGAGATTTACCTCCATTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009808.4-1687s21c1
Sequence:CCGGTGAACCACTTTCACCTATAAACTCGAGTTTATAGGTGAAAGTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009808.4-1165s21c1
Sequence:CCGGGTACTGTTGGTGTTATCATTTCTCGAGAAATGATAACACCAACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-1406s1c1
Sequence:CCGGGCTAGATAATTTCCATAGGTTCTCGAGAACCTATGGAAATTATCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-550s1c1
Sequence:CCGGGCTCTCATCATCTGCAACAAACTCGAGTTTGTTGCAGATGATGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-1220s1c1
Sequence:CCGGTGCCCACTATTGAGAGAGTATCTCGAGATACTCTCTCAATAGTGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009808.2-46s1c1
Sequence:CCGGGATCCAATCTACAAGATCAAACTCGAGTTTGATCTTGTAGATTGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009808.2-1065s1c1
Sequence:CCGGCCCACATAATATTTCTTGGAACTCGAGTTCCAAGAAATATTATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks